ID: 1202043248

View in Genome Browser
Species Human (GRCh38)
Location Y:20709695-20709717
Sequence TCGCAATAAACAATGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202043246_1202043248 16 Left 1202043246 Y:20709656-20709678 CCAGACTAATAAAGAAGAAAAGA 0: 851
1: 853
2: 440
3: 403
4: 1639
Right 1202043248 Y:20709695-20709717 TCGCAATAAACAATGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202043248 Original CRISPR TCGCAATAAACAATGATGAA AGG Intergenic
No off target data available for this crispr