ID: 1202046226

View in Genome Browser
Species Human (GRCh38)
Location Y:20739260-20739282
Sequence GAACCCTATTGTCACTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202046219_1202046226 21 Left 1202046219 Y:20739216-20739238 CCAGGACGATAGGCATCAGATAG No data
Right 1202046226 Y:20739260-20739282 GAACCCTATTGTCACTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202046226 Original CRISPR GAACCCTATTGTCACTCCTT AGG Intergenic
No off target data available for this crispr