ID: 1202050254

View in Genome Browser
Species Human (GRCh38)
Location Y:20773477-20773499
Sequence GGCATGACTTATCATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202050245_1202050254 23 Left 1202050245 Y:20773431-20773453 CCTAAATTCCTATCTAAGGCGTC 0: 2
1: 126
2: 247
3: 174
4: 165
Right 1202050254 Y:20773477-20773499 GGCATGACTTATCATCAGATGGG 0: 1
1: 0
2: 2
3: 7
4: 106
1202050248_1202050254 15 Left 1202050248 Y:20773439-20773461 CCTATCTAAGGCGTCTTGGGAAT 0: 1
1: 0
2: 7
3: 147
4: 270
Right 1202050254 Y:20773477-20773499 GGCATGACTTATCATCAGATGGG 0: 1
1: 0
2: 2
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202050254 Original CRISPR GGCATGACTTATCATCAGAT GGG Intronic
904221740 1:28976046-28976068 TGCATAACTTCTCAACAGATAGG + Intronic
905516610 1:38566535-38566557 GGCATCAGTCGTCATCAGATGGG - Intergenic
906047046 1:42839207-42839229 GGCATGACATTTCCTTAGATGGG + Intronic
907382483 1:54102742-54102764 GCCATGCCTTATCCTTAGATAGG + Intronic
909768247 1:79385852-79385874 AACAGGATTTATCATCAGATTGG + Intergenic
911434266 1:97835551-97835573 GGAATGAATTATCAGCAGGTAGG - Intronic
912346484 1:108967918-108967940 ACCATGACTTCTCATCAGATGGG - Intergenic
919452677 1:197789115-197789137 GGCATGCCTTAGCACCAGATAGG + Intergenic
1063133874 10:3199943-3199965 AGCATCAGTTATGATCAGATGGG - Intergenic
1067727569 10:48782134-48782156 GGCTGGACTTATCATTAGAGAGG + Intronic
1069048348 10:63766166-63766188 GCCATAAATTCTCATCAGATGGG + Intergenic
1070991457 10:80736559-80736581 ACCATAACTTCTCATCAGATGGG + Intergenic
1073867790 10:107825044-107825066 ACCATCAATTATCATCAGATGGG - Intergenic
1075278743 10:121120196-121120218 GGCATTTTTCATCATCAGATTGG + Intergenic
1077844671 11:6012328-6012350 GGCATGACCTATCTGCAGAAAGG - Intergenic
1081526102 11:43928758-43928780 GGAATGACTTATAAGCAGCTTGG - Intronic
1083796524 11:65020070-65020092 TGCATGTCTGGTCATCAGATTGG + Intronic
1088954798 11:114607576-114607598 GGCATGACTTATTATCCACTGGG - Intergenic
1088955485 11:114611988-114612010 GGCATGACTTATTATCCACTGGG - Intergenic
1091206104 11:133822269-133822291 GGCATTTCTGATCAGCAGATGGG - Intergenic
1092500826 12:9045087-9045109 GGCATGACTTATAAAGAGCTTGG + Intergenic
1093163706 12:15780857-15780879 GGCATGAGTTTTCCTCACATAGG - Intronic
1094473664 12:30825232-30825254 GGCTTGACATACCATCAGTTTGG + Intergenic
1095503076 12:42861890-42861912 GGCATGATGTTTCTTCAGATTGG + Intergenic
1099268319 12:80477377-80477399 GGCATTAATTATCACCAAATAGG + Intronic
1099338812 12:81400473-81400495 GGCAAGAATAATCCTCAGATCGG - Intronic
1100625155 12:96323896-96323918 TGCATGACGTATAATCAGAAAGG + Intronic
1103154165 12:118669062-118669084 GGCATGATTTATAATCCGTTGGG + Intergenic
1104259285 12:127167716-127167738 GGCATGACTGAGCCTCAGATTGG + Intergenic
1110810709 13:79808192-79808214 GGGATGACTTGTCAGCAGAGAGG + Intergenic
1111023667 13:82489779-82489801 AGAATGACTTCCCATCAGATAGG - Intergenic
1111304561 13:86390340-86390362 GGCAGGACCTGTCATCAGTTTGG + Intergenic
1117672297 14:58120990-58121012 ATCATGAATTTTCATCAGATGGG - Intronic
1124353132 15:28974038-28974060 GGCAAGACTGATTTTCAGATTGG + Intronic
1130071719 15:80652134-80652156 AGAATGACTTATCAGCAGATGGG - Intergenic
1135634830 16:24066382-24066404 TGCATGGCTTAGCAGCAGATTGG - Intronic
1135997425 16:27261850-27261872 GGAATGACATATCATCACTTAGG + Intronic
1137840224 16:51634043-51634065 GTCAAGTCTTAACATCAGATTGG - Intergenic
1137884436 16:52087435-52087457 ACCATGAATTCTCATCAGATGGG + Intergenic
1139058126 16:63212632-63212654 GGCATGAGGTATTATCACATTGG - Intergenic
1140805095 16:78525931-78525953 AGCATGATTTATCATTTGATTGG + Intronic
1149077142 17:52608841-52608863 TGCATGACTTAGCATTAGATTGG - Intergenic
1149136061 17:53366060-53366082 GCCATAAATTATCATCAGATGGG + Intergenic
1153136226 18:1920562-1920584 GCCATAAATTCTCATCAGATGGG - Intergenic
1155442926 18:25880937-25880959 AGAATGACTTATCATCAGATTGG + Intergenic
1158595106 18:58809053-58809075 GGCATGACTTATCTGCATAGAGG + Intergenic
926748572 2:16180400-16180422 AGCCTGACTTATCATCAGGCAGG - Intergenic
931144163 2:59498457-59498479 GGCAGGCCTTGTCTTCAGATTGG + Intergenic
931416856 2:62089716-62089738 ACCATGAATTCTCATCAGATGGG - Intronic
932022505 2:68101875-68101897 GGCATGACTAAAAATCAGACTGG - Intronic
932689135 2:73897490-73897512 GGCCTGACTTAGAATCACATGGG - Intronic
933842777 2:86300893-86300915 TGCATGATTTTTCATCAGAGGGG - Intronic
936787753 2:116114721-116114743 GCCATAAATTCTCATCAGATGGG - Intergenic
937685227 2:124688745-124688767 GTAATGACTTTTCATCAGTTTGG - Intronic
942786673 2:179708985-179709007 CGCCTCTCTTATCATCAGATGGG - Intronic
943394937 2:187322417-187322439 GGCATCATTTATCATCAGAAAGG + Intergenic
944487361 2:200221027-200221049 GGGATGACATTTCCTCAGATGGG - Intergenic
946911059 2:224461432-224461454 GGCATTTGTTATCATCAGTTTGG - Intergenic
1175659398 20:60799040-60799062 GGCATGTCTCTTCCTCAGATAGG - Intergenic
1176995334 21:15548741-15548763 GGCTTGACTTCTCATCCCATGGG - Intergenic
1182051182 22:27314020-27314042 GGGATGACTTATCTTGAGCTGGG - Intergenic
1184374532 22:44103349-44103371 TGCATGGCTGATCATCAGCTGGG + Intronic
949111692 3:269226-269248 TGCATCATTTATGATCAGATGGG + Intronic
951332655 3:21384995-21385017 AGCATAAATTCTCATCAGATGGG - Intergenic
954604200 3:51895873-51895895 ATCATAACTTCTCATCAGATGGG + Intronic
958622401 3:96577734-96577756 GGCATGTTTTATCATTAGCTAGG - Intergenic
959405918 3:105961575-105961597 ACCATAAATTATCATCAGATGGG + Intergenic
959817236 3:110688772-110688794 GGCATAACATAAGATCAGATTGG + Intergenic
963386808 3:144607412-144607434 GGGATGAATTATAATCAGAGTGG + Intergenic
963627555 3:147692108-147692130 GGCAGGAGTTATCATCAAGTAGG - Intergenic
964261718 3:154846986-154847008 AGCATGACTTATAATCAAAATGG - Intergenic
964855033 3:161137697-161137719 GGCATGCCTGATCATCCTATGGG + Intronic
967661213 3:192112763-192112785 GGCATGATTTATCATATGGTTGG - Intergenic
971964378 4:33533409-33533431 GGCTTGACTTTTCAGCAAATAGG + Intergenic
977486340 4:97650939-97650961 AGCATAAATTCTCATCAGATGGG - Intronic
979224515 4:118269069-118269091 GGCAGGGCTTATCTTCAAATGGG - Intergenic
980482327 4:133402766-133402788 CTCATGACTCATCATCAGACTGG - Intergenic
980638700 4:135543552-135543574 GGCATAACTTATCATCATTATGG + Intergenic
983273836 4:165593669-165593691 AGCATAAATTCTCATCAGATGGG - Intergenic
984526987 4:180869079-180869101 GGCATCACTTATCAGCTGACTGG - Intergenic
984851264 4:184154978-184155000 GGCATGACATTTATTCAGATTGG - Intronic
988435682 5:31172214-31172236 GACATGACCTATAAACAGATAGG - Intergenic
990077425 5:51866511-51866533 AGCATGAATTATCATGAGTTGGG - Intergenic
990421176 5:55635448-55635470 GGCAAGATATAACATCAGATAGG - Intronic
992157385 5:73968741-73968763 GACAAGACTTACCATCAGAGTGG - Intergenic
992414871 5:76542671-76542693 GACAGGTCTTATCAACAGATTGG + Intronic
997805989 5:136918401-136918423 GGCAGGATTGCTCATCAGATGGG - Intergenic
1005338927 6:24824712-24824734 GGCATGTCTTATGAGCAGTTTGG - Intronic
1006507927 6:34502423-34502445 TACATGACTTATCCTCAGCTGGG - Intronic
1010303621 6:74290059-74290081 AGCAAGACTAATCACCAGATGGG - Intergenic
1012602726 6:101117635-101117657 GGCAGGAAGGATCATCAGATTGG + Intergenic
1026496691 7:70909699-70909721 ATCATGAATTCTCATCAGATGGG - Intergenic
1026514384 7:71055624-71055646 GGCATGACTGCTCATAGGATGGG + Intergenic
1028914465 7:96243311-96243333 GGCATGGCTTATCATATAATAGG - Intronic
1029710368 7:102295908-102295930 GGCAGGACTTATCAGGACATTGG - Intronic
1030495067 7:110288570-110288592 ACCATAAATTATCATCAGATGGG + Intergenic
1035369142 7:158367777-158367799 GGAATGACTGAGCATCTGATGGG - Intronic
1035889793 8:3330822-3330844 GGAATGAATTATCAGCAGGTAGG + Intronic
1041609304 8:59826078-59826100 ACCATAAATTATCATCAGATGGG + Intergenic
1042986528 8:74589946-74589968 AGCATTTCTTCTCATCAGATAGG - Intergenic
1043981388 8:86644309-86644331 GGAATGAATTATCATGAGAAAGG + Intronic
1046245544 8:111556171-111556193 AGCATGATTTATAATCATATGGG + Intergenic
1046778604 8:118191125-118191147 GGCTTGACTTTTCAGCAGACTGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049001156 8:139826363-139826385 GGCAGGGCTTCTCAGCAGATGGG + Intronic
1049075662 8:140394337-140394359 GGCAAGTGTTATGATCAGATTGG - Intronic
1054703215 9:68434991-68435013 GGCAGGACTTATCAGGAGAATGG - Intronic
1055273478 9:74587679-74587701 GGCATGACTTATCCTCCAGTAGG + Intronic
1188390252 X:29610953-29610975 ACCATGAATTCTCATCAGATGGG + Intronic
1189552348 X:42106315-42106337 GGCATGCCTTTTCAACAGAAGGG - Intergenic
1189996416 X:46643231-46643253 GTCATGGCTTAACATCAGGTTGG - Exonic
1192087613 X:68116418-68116440 GCCATAAATTCTCATCAGATGGG - Intronic
1197443895 X:126524862-126524884 AGCATGACTTATAATCCGTTGGG - Intergenic
1198140930 X:133802765-133802787 GGCAGGAATTCTCATTAGATGGG - Intronic
1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG + Intronic
1202050254 Y:20773477-20773499 GGCATGACTTATCATCAGATGGG + Intronic