ID: 1202050311

View in Genome Browser
Species Human (GRCh38)
Location Y:20774044-20774066
Sequence CACTTTGGGCACGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2700
Summary {0: 2, 1: 60, 2: 535, 3: 846, 4: 1257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202050306_1202050311 -6 Left 1202050306 Y:20774027-20774049 CCGAGCTGTGTCCTGACCACTTT 0: 2
1: 15
2: 172
3: 487
4: 1111
Right 1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG 0: 2
1: 60
2: 535
3: 846
4: 1257
1202050304_1202050311 14 Left 1202050304 Y:20774007-20774029 CCCTTCTAAAGTGTATAAAACCG 0: 1
1: 0
2: 7
3: 96
4: 400
Right 1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG 0: 2
1: 60
2: 535
3: 846
4: 1257
1202050305_1202050311 13 Left 1202050305 Y:20774008-20774030 CCTTCTAAAGTGTATAAAACCGA 0: 1
1: 0
2: 6
3: 48
4: 195
Right 1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG 0: 2
1: 60
2: 535
3: 846
4: 1257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202050311 Original CRISPR CACTTTGGGCACGTGTTCTC AGG Intronic
Too many off-targets to display for this crispr