ID: 1202051855

View in Genome Browser
Species Human (GRCh38)
Location Y:20789594-20789616
Sequence CTTTGTGAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202051855_1202051860 -8 Left 1202051855 Y:20789594-20789616 CCTTCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 1202051860 Y:20789609-20789631 TCACAAAGTGCTAGGATTACAGG 0: 184
1: 24886
2: 323401
3: 256019
4: 134924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202051855 Original CRISPR CTTTGTGAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr