ID: 1202051885

View in Genome Browser
Species Human (GRCh38)
Location Y:20789915-20789937
Sequence CCTTTTAAGCATTTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202051879_1202051885 11 Left 1202051879 Y:20789881-20789903 CCTAAAGGTGAGCCCAGAACAAA No data
Right 1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG No data
1202051880_1202051885 -1 Left 1202051880 Y:20789893-20789915 CCCAGAACAAAGAAAACGAGTCC 0: 2
1: 3
2: 4
3: 13
4: 199
Right 1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG No data
1202051881_1202051885 -2 Left 1202051881 Y:20789894-20789916 CCAGAACAAAGAAAACGAGTCCC 0: 2
1: 3
2: 3
3: 8
4: 104
Right 1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG No data
1202051877_1202051885 27 Left 1202051877 Y:20789865-20789887 CCTAGCAGACATTTGTCCTAAAG No data
Right 1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202051885 Original CRISPR CCTTTTAAGCATTTTGAGGC AGG Intergenic
No off target data available for this crispr