ID: 1202051952

View in Genome Browser
Species Human (GRCh38)
Location Y:20790811-20790833
Sequence GCCTCCGGTGTGGTCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202051948_1202051952 8 Left 1202051948 Y:20790780-20790802 CCTTAAGCTTCAGTCGTGCATAG No data
Right 1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202051952 Original CRISPR GCCTCCGGTGTGGTCAGAGC AGG Intergenic
No off target data available for this crispr