ID: 1202056323

View in Genome Browser
Species Human (GRCh38)
Location Y:20835282-20835304
Sequence CCACTTATAAGTGAGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1293
Summary {0: 7, 1: 124, 2: 273, 3: 409, 4: 480}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202056323_1202056328 -8 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056328 Y:20835297-20835319 ATAAGTGGGACTATGCTATGGGG No data
1202056323_1202056330 1 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056330 Y:20835306-20835328 ACTATGCTATGGGGGTGCAAAGG No data
1202056323_1202056327 -9 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056327 Y:20835296-20835318 TATAAGTGGGACTATGCTATGGG No data
1202056323_1202056329 -7 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056329 Y:20835298-20835320 TAAGTGGGACTATGCTATGGGGG No data
1202056323_1202056335 30 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056335 Y:20835335-20835357 AAGGTTATAATGAACTCTGGGGG No data
1202056323_1202056333 28 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056333 Y:20835333-20835355 AGAAGGTTATAATGAACTCTGGG No data
1202056323_1202056334 29 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056334 Y:20835334-20835356 GAAGGTTATAATGAACTCTGGGG No data
1202056323_1202056332 27 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056332 Y:20835332-20835354 AAGAAGGTTATAATGAACTCTGG No data
1202056323_1202056331 11 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056331 Y:20835316-20835338 GGGGGTGCAAAGGCAGAAGAAGG No data
1202056323_1202056326 -10 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056326 Y:20835295-20835317 TTATAAGTGGGACTATGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202056323 Original CRISPR CCACTTATAAGTGAGAACAC AGG (reversed) Intergenic
900039572 1:447114-447136 TCATTTATGAGTGAGAACATCGG - Intergenic
900061003 1:682090-682112 TCATTTATGAGTGAGAACATCGG - Intergenic
900627827 1:3617396-3617418 CCACTCATAAGTGAGAACATGGG - Intergenic
902763200 1:18597843-18597865 CCACTTTGCAGTGAGAACAGAGG + Intergenic
902831817 1:19019374-19019396 CCACTTATAAGTAAGAACATGGG + Intergenic
903007438 1:20308104-20308126 TCACTTACAAGTGAGAACATGGG + Intronic
903323367 1:22555629-22555651 TGACTTCTAAGTGTGAACACGGG - Intergenic
903365639 1:22804060-22804082 CGTCTTACAAGTGAGAAAACAGG + Intronic
904910141 1:33928526-33928548 CCATTTACAAATGAGAAAACTGG + Intronic
904957207 1:34294931-34294953 CCACTTATAAGTGAGAACATGGG - Intergenic
905339603 1:37269374-37269396 CCACTTATGGCTGAGAACATAGG - Intergenic
906361926 1:45168240-45168262 CCACCTGTGAGCGAGAACACGGG - Intronic
906826262 1:48983748-48983770 TCTCTTATAATTGAGAAAACTGG - Intronic
906870889 1:49479531-49479553 CCACTTATAAGTGAGAACGTGGG + Intronic
906872542 1:49499578-49499600 TCACTTATAAGTGGGAACTAAGG - Intronic
907572169 1:55493286-55493308 CCACTTATAAGTGAGAACATGGG + Intergenic
907847836 1:58225727-58225749 CCACCTATGAGTGAGAACATGGG - Intronic
908080145 1:60568392-60568414 CCACTTATTAGGGAGAACAAAGG + Intergenic
908091461 1:60690080-60690102 CCACTTATAAGTGAGAATGTGGG - Intergenic
908527546 1:65002470-65002492 TCACTTAGAAGTGAGGAAACAGG - Intergenic
908706783 1:66965887-66965909 CCACACATAATTGAGAACATGGG + Intronic
909166611 1:72234210-72234232 CCACTAGTAAGCGAGAACATGGG + Intronic
909196280 1:72629107-72629129 CCATTTACAAATGAGAAAACAGG + Intergenic
909449539 1:75783500-75783522 CCACCTATGAGTGAGAACATGGG - Intronic
909458138 1:75873637-75873659 CCACTTTTAAGTGAAAACATGGG + Intronic
909880957 1:80877546-80877568 CCACTTATAAGTGAGAACATGGG + Intergenic
909960811 1:81839605-81839627 CTACATATCAGTGAGAACATGGG + Intronic
910224229 1:84919910-84919932 CCACTTATTTGTGAGGACAGAGG + Intergenic
910266820 1:85346648-85346670 TCACTTATAAGTGATAAAAGTGG - Intronic
910271825 1:85403900-85403922 CCATTTGTAAGTAAGCACACAGG - Intronic
910296180 1:85647777-85647799 CCACCTATGAGTGAGAATATGGG - Intergenic
910413166 1:86967524-86967546 CTACTTATAAGTGAGAACATAGG + Intronic
910419044 1:87036047-87036069 CCACTTATGAGTGAAAACATTGG + Intronic
910600552 1:89027300-89027322 CCACTTATAAGTGAGAACACAGG + Intergenic
910601825 1:89040735-89040757 CCACTTATAAGTGAGAATATGGG - Intergenic
910753041 1:90655067-90655089 CCACTTACAAGTGAGAAATGTGG - Intergenic
910763121 1:90754755-90754777 CCACATATTAATGAGAACATGGG + Intergenic
911243734 1:95493834-95493856 CCAGTTATGAGTGAGAACATGGG + Intergenic
911332275 1:96539158-96539180 CCACTTATAATGAAAAACACAGG + Intergenic
911366976 1:96950355-96950377 CATCTTATATGTGAGAAAACAGG - Intergenic
911384805 1:97161796-97161818 CCACCTATGAGTGAGAACATGGG + Intronic
911392678 1:97266754-97266776 CTACCTATGAGTGAGAACATGGG + Intronic
911487685 1:98522976-98522998 CCACAAATAAGTAAGAACATAGG - Intergenic
911493209 1:98595132-98595154 CCACAAATAAGTGAGAACACAGG + Intergenic
912032998 1:105273437-105273459 CCACTTATGAGTGAGAACATAGG + Intergenic
912081547 1:105943533-105943555 CCACCTATGAGTGAGAACATGGG + Intergenic
912197600 1:107417597-107417619 CCACATATCGGTGAGAAAACAGG + Intronic
912707049 1:111922572-111922594 CCACTTAAAAGAGAGGAAACAGG - Intronic
913356157 1:117924358-117924380 CCACTTATAAGTGAGACCATAGG + Intronic
913584527 1:120261028-120261050 CCATTTATGTGTGAGAACATAGG - Intergenic
913623657 1:120637331-120637353 CCATTTATGTGTGAGAACATAGG + Intergenic
914347681 1:146814048-146814070 CCACTTCCAAGTGAGAACATGGG - Intergenic
914449351 1:147776981-147777003 CCACTTAGAAGTCAGAACACGGG + Intergenic
914566524 1:148872884-148872906 CCATTTATGTGTGAGAACATAGG - Intronic
914606295 1:149257356-149257378 CCATTTATGTGTGAGAACATAGG + Intergenic
915060780 1:153182616-153182638 CCACTTATGAGTGAGAACTTAGG + Intergenic
915747484 1:158175489-158175511 CAACTTTTAAGTGTGGACACTGG + Intergenic
916383951 1:164246026-164246048 CCACTGTTAAGTATGAACACAGG + Intergenic
916604191 1:166325011-166325033 CTTCTTATAAGAGAGAACAAGGG - Intergenic
916648274 1:166810735-166810757 CCACTTACAAGTGAGAACATGGG + Intergenic
916924825 1:169507209-169507231 CCCCTTATGAGTGAGAACATGGG - Intergenic
917062361 1:171055275-171055297 CCACTTATAAGTGAGAACACAGG - Intronic
917159139 1:172037890-172037912 CCACTTAGTCCTGAGAACACCGG + Intronic
917228346 1:172808240-172808262 CCACTTATAAGTGAGAACATGGG + Intergenic
917248898 1:173035767-173035789 CCACTTATGAGTGAGAACATGGG - Intergenic
917382742 1:174432186-174432208 CTACTTACAAGTGAGAACATGGG + Intronic
917573447 1:176294846-176294868 CCACCTATGAGTGAGAACATGGG + Intergenic
917582668 1:176395315-176395337 CCACTTATAAGTGAAAAATGTGG + Intergenic
917867220 1:179208377-179208399 CCACTTATAAGTGAGAACACAGG + Intronic
918127777 1:181599190-181599212 CCACTTATAAGTGAGAACATGGG + Intronic
918288018 1:183077629-183077651 CCACATATCAGTGAGAACATAGG + Intronic
918429959 1:184449274-184449296 CCACCTATGAGTGACAACATGGG + Intronic
918494745 1:185122014-185122036 CCACTTGTAAGTTAGAACATGGG + Intronic
918566875 1:185944231-185944253 GCACTTATAAGCGAGAACATAGG - Intronic
918639799 1:186826314-186826336 CCACCTATGAGTGAGAACATGGG - Intergenic
918756103 1:188340701-188340723 CCACCTATGAGTGAGAACATGGG - Intergenic
918798027 1:188930721-188930743 CCACTTATAAGTAAGAACACTGG - Intergenic
918837350 1:189484428-189484450 CCATTTATGAGTGAGAACATGGG - Intergenic
918972872 1:191443019-191443041 CCACCTATGAGTGAGAACATGGG + Intergenic
919034484 1:192289204-192289226 CCACCTACAAGTGAGGACATAGG - Intergenic
919086349 1:192925097-192925119 CTACTTATAAGTGAGAAGAGTGG - Intergenic
919112632 1:193240087-193240109 CCACATAAAAGTGAGAACATAGG + Intronic
919126967 1:193406573-193406595 CCACATATGAGTGACAACATGGG + Intergenic
919138057 1:193535438-193535460 CCACAGATGAGTGAGAACATGGG + Intergenic
919148327 1:193663036-193663058 CCACCTATGAGTGAGAACATGGG + Intergenic
919150451 1:193690476-193690498 CCACCTATGAGTGAGAACATGGG + Intergenic
919389520 1:196964748-196964770 CCACTTATAAGTGAGAACATGGG - Intergenic
919409922 1:197229682-197229704 TCACTCGTAAGTGAGAACATGGG + Intergenic
919724228 1:200871833-200871855 CCACTCATACCTGGGAACACTGG + Intergenic
920411817 1:205767644-205767666 CCACTTACAAGTGAGAAATGTGG - Intergenic
920542436 1:206789412-206789434 CCACTTGTAAGTGAGAACATGGG + Intergenic
920783219 1:209014696-209014718 CCACTTCTAAGTGAGAACAGAGG - Intergenic
920931254 1:210390725-210390747 CTACTCATAAGTGAGAACATAGG + Intronic
921440133 1:215175725-215175747 CCACTTATAAGTGAGAACATAGG + Intronic
921852392 1:219944914-219944936 CCACTTAAAAGACAGAAAACTGG + Intronic
921921025 1:220669690-220669712 CCACCTGTAAGTGAGATCATAGG - Intergenic
921949729 1:220916912-220916934 CATCTTACAAGTGAGAACTCTGG - Intergenic
922331200 1:224577984-224578006 CTGCTCATAAGTGAGAACATAGG - Intronic
922641960 1:227243088-227243110 CCACTTACAAGTGAGAACATGGG - Intronic
922743058 1:228026687-228026709 CCACTTATAAGTGAGAACATAGG + Intronic
923192872 1:231637029-231637051 CCACTTATGAGTGAGAACATGGG + Intronic
923431175 1:233921868-233921890 CCACCTGTGAGTGAGAACATGGG + Intronic
923472199 1:234301955-234301977 CCACTTATGAGTGAGAATGTGGG - Intronic
923827738 1:237518487-237518509 CCACTTGTGAATGAGAACATGGG + Intronic
924398357 1:243649638-243649660 CCACTTATGAATGAGAACATGGG + Intronic
924618476 1:245636725-245636747 CCACATATGAGTGACAACATGGG + Intronic
924621978 1:245669904-245669926 CCACTTATACCTGAGAACATAGG - Intronic
924650451 1:245921758-245921780 CCACTTATAAGTGAGAACATTGG - Intronic
924937136 1:248781610-248781632 CCATTTAAAAGGGAGAATACAGG - Intergenic
1063134331 10:3203078-3203100 CCACTTATACATGAGAACATGGG + Intergenic
1063182817 10:3621423-3621445 CCATTTATGAGTGAGAACACAGG - Intergenic
1063613471 10:7582751-7582773 CCACAAATAAGCGAGAACATGGG - Intronic
1063747125 10:8896989-8897011 CCACGTATAAGTGAGAATATTGG + Intergenic
1063821268 10:9839190-9839212 CCACTCATGAGTGAGAACATAGG - Intergenic
1063990189 10:11553046-11553068 CTACTTATAAGTGAGAACACTGG + Intronic
1064215130 10:13394039-13394061 CCACTTATAAGTGAGAACATGGG - Intergenic
1064527136 10:16268656-16268678 CCACTTATAAGTCAGAACATGGG + Intergenic
1064896222 10:20240155-20240177 ACACTTACAAGTGAGAACATAGG + Intronic
1065634985 10:27722625-27722647 CCACTTGTAGATGAGACCACAGG - Intronic
1065663283 10:28029030-28029052 CCACTTATAAGAGAGAACACAGG - Intergenic
1066025143 10:31349146-31349168 CCACGTATAAGTGAGATCATTGG + Intronic
1066143946 10:32536739-32536761 CCCCTTATAAGTAAGATCATGGG + Intronic
1066476714 10:35753914-35753936 CCACTTATTGGTGAGAACATAGG + Intergenic
1066753399 10:38683782-38683804 CCACTTATAAGTGAGAATATGGG - Intergenic
1066788152 10:39028872-39028894 CCACCTATGAGTGAGAATATGGG - Intergenic
1068184549 10:53568013-53568035 CCACTTATAAGTGAGTAAATAGG - Intergenic
1068272036 10:54740784-54740806 CCGCATATTAGTGAGAACATGGG - Intronic
1068384769 10:56311478-56311500 CCACTTATAAGTAAGAACATAGG - Intergenic
1068462496 10:57345697-57345719 CTACTTATAGGTGAGAACATGGG + Intergenic
1068479031 10:57565207-57565229 CCACATATGAATGAGAACATGGG + Intergenic
1069263764 10:66432873-66432895 CCATTTATTAGTGAGAACATAGG + Intronic
1069562464 10:69440467-69440489 CCAATTACAAATGAGAAAACAGG - Intergenic
1069942944 10:71967400-71967422 CCACTTCTAAGTGAGAGCATGGG + Intronic
1070547019 10:77460699-77460721 CCACTTATAAGTGACAACATGGG - Intronic
1070571747 10:77645155-77645177 CCACTTACAAGTGAGAACATGGG - Intergenic
1070988132 10:80706197-80706219 CCACTTATAAGGGAGGACATTGG - Intergenic
1071059904 10:81557413-81557435 CCACTTATGAGTGAGAAATGCGG + Intergenic
1071193258 10:83127159-83127181 CCACTTATGAGTGAGAACATGGG - Intergenic
1071377064 10:85017389-85017411 TCCTGTATAAGTGAGAACACGGG + Intergenic
1071870431 10:89788138-89788160 CTACGTATCAGTGAGAACATAGG + Intergenic
1072359959 10:94649780-94649802 CCATTTATAAGTGAGAAATGTGG + Intergenic
1072940797 10:99761899-99761921 CCACTTATAAGTGAGAACATGGG - Intergenic
1073007036 10:100332265-100332287 CCACATATAAGTGAGAGCATAGG - Intergenic
1073019205 10:100427692-100427714 CCACTTATAAGTGAGAATATGGG - Intergenic
1073784290 10:106871657-106871679 CCACTTATGAATGAGAACATGGG - Intronic
1073881746 10:107989682-107989704 CCACTTATAAGTGAGAACATGGG - Intergenic
1073890284 10:108092933-108092955 CCACAAATCAGTGAGAACATGGG - Intergenic
1073913251 10:108371571-108371593 CCACTTATAAGTGAGAACATAGG + Intergenic
1073981140 10:109155205-109155227 CCACCTATGAGTGAGAACATGGG - Intergenic
1074245229 10:111683729-111683751 CTAATTATAAGTGAGATCACAGG - Intergenic
1074462553 10:113651566-113651588 CCACTTATAAGTGAGAACATGGG + Intronic
1074633554 10:115287953-115287975 CCACTTATGAATGAGAACACAGG + Intronic
1076345601 10:129776843-129776865 CCACTTATAAGTGAGAACATGGG + Intergenic
1076609557 10:131713554-131713576 CCAGATATAAGTGAGCTCACGGG + Intergenic
1076965793 11:83026-83048 CCATTTATGAGTGAGAACATCGG - Intergenic
1077960022 11:7065933-7065955 CCACTTACAAGTGAGAATATGGG + Intronic
1078109456 11:8381030-8381052 CCACCTGTAAGTGAGGACATAGG - Intergenic
1078272293 11:9807359-9807381 TCACTTATAAGTGGGAGCCCAGG - Intronic
1078370547 11:10741093-10741115 CTACTTATAAGTGAGAACATGGG - Intergenic
1078982301 11:16550232-16550254 CCACCTATGAGTTAGAACATGGG - Intronic
1079593075 11:22205112-22205134 CAACTTATAAGTGAGAACATGGG - Intronic
1079929565 11:26541211-26541233 CCAGTTATGAGTGAGAACATGGG - Intronic
1080092306 11:28362562-28362584 CCACTTATAAGTGACAACATGGG + Intergenic
1080195897 11:29608389-29608411 CCACTTATAAGTGAGAGCGTAGG - Intergenic
1080234057 11:30048268-30048290 CCACTTATAAATGAGAACATGGG + Intergenic
1080249786 11:30219911-30219933 CCACTAATGAGTGAGAACATGGG + Intergenic
1081093721 11:38904964-38904986 CCAGTTATGAGTAAGAACATGGG - Intergenic
1081101612 11:39008713-39008735 CCACTGATGAGTGAAAACATAGG + Intergenic
1081353346 11:42082681-42082703 CAATTTATAGGTGAGAAAACTGG - Intergenic
1081452991 11:43191192-43191214 CCACTGATAAGAGAGAGCATGGG + Intergenic
1081463931 11:43299184-43299206 CCACAAATAAGTGAGAACAGTGG - Intergenic
1081514784 11:43816841-43816863 CCACTTATAAGTGAGAACACAGG + Intronic
1082183490 11:49149027-49149049 CCACCTATGAGTGAGATAACGGG - Intronic
1082199345 11:49344863-49344885 TCACTTGTGAGTGAGAACACAGG + Intergenic
1082701555 11:56438082-56438104 CCACTTGTAAGTGAGAACATAGG + Intergenic
1082868930 11:57925567-57925589 CCACTTGTGAGTGAGAACTCAGG + Intergenic
1082897714 11:58210170-58210192 CCACATATAAGTGAGATCATGGG + Intergenic
1083015135 11:59445235-59445257 TTACTTACAAGTGAGAACATTGG + Intergenic
1083068649 11:59952550-59952572 CCACTTATAAGTGAGAACAGAGG - Intergenic
1083406014 11:62457696-62457718 CCACTTATAAGTGAGAAATGTGG - Intronic
1083547698 11:63561236-63561258 CCACTTACGAGTGAGAACATAGG - Intronic
1084774195 11:71364723-71364745 TCACTAATGAGTGAGGACACAGG + Intergenic
1084955852 11:72691182-72691204 CCACTTCCAGGTGAGAAAACAGG - Intronic
1085155509 11:74289670-74289692 CCACCTATGAGTGAGAACATGGG + Intronic
1085248532 11:75125224-75125246 CCACCTATGAGTGAGAACATGGG - Intronic
1085586841 11:77716534-77716556 CCACATGTAAGTGAGATCATGGG - Intronic
1085728721 11:78978119-78978141 CCACTTATGAGTGAGAATATGGG - Intronic
1085902194 11:80714530-80714552 CCACTTATAAGTGAGAACATGGG - Intergenic
1085977221 11:81672672-81672694 CCACAAATAAGTGAGAACATGGG - Intergenic
1086272904 11:85089359-85089381 CCACTTATAAGTGGGAACATGGG + Intronic
1086295745 11:85365849-85365871 CCACTTATGAGTGAGAACATGGG - Intronic
1086313124 11:85558706-85558728 CTATGTATAAGTGAGAACATGGG - Intronic
1086656336 11:89361365-89361387 TCACTTATAAGTGAGAACACAGG - Intronic
1086682873 11:89696318-89696340 CCACCTATGAGTGAGATAACGGG + Intergenic
1086751112 11:90494708-90494730 CCACTTATAAGTGAGAACATGGG + Intergenic
1087005831 11:93470292-93470314 TCACTTATAAGTGACAACATGGG + Intergenic
1087010504 11:93509733-93509755 CCAATTATGAGTGAGAACATAGG - Intronic
1087036319 11:93759411-93759433 CCACTTATGAGTGAGAACATGGG - Intronic
1087120752 11:94571510-94571532 CCACCTATAAGAGAGAACATGGG + Intronic
1087343481 11:96938450-96938472 CCACCTATAAGTGAGAGCATGGG + Intergenic
1087627697 11:100615638-100615660 CCACTTATAAGTGAGGACATAGG - Intergenic
1087714896 11:101596495-101596517 CCACAAATGAGTGAGAACATGGG - Intronic
1088310864 11:108459010-108459032 CCACTCCTGAGTGAGAACACTGG - Intronic
1088406974 11:109492065-109492087 CCACCTATAAGTGAGAATATGGG + Intergenic
1088583228 11:111335145-111335167 CCACTTACAAGTTAGCCCACTGG - Intergenic
1089018436 11:115186621-115186643 CCATTTATAAATGAGGAAACTGG - Intronic
1089981339 11:122775287-122775309 CCACTTGTAAGTTTGTACACAGG + Intronic
1090495343 11:127206203-127206225 CCACATAGAAGTGGGACCACTGG - Intergenic
1090537599 11:127661375-127661397 CCACATATTAGTGAGAACACAGG + Intergenic
1090695372 11:129235786-129235808 CCACTCATAAGTGAGAATATAGG + Intronic
1091070755 11:132560581-132560603 CCATTTATGAGTGAGAACAAAGG + Intronic
1091422182 12:351284-351306 CCACTTATGAGTGAGAACGTGGG + Intronic
1091633718 12:2181779-2181801 CCTTTTATAGATGAGAACACTGG + Intronic
1092023728 12:5223438-5223460 CCATTTAGAAAGGAGAACACTGG + Intergenic
1092314416 12:7395360-7395382 CCACCTATGAGTGAGAACATGGG - Intronic
1092504167 12:9078266-9078288 CCACTTATGAGTGAGAAATGTGG + Intronic
1093178532 12:15941600-15941622 CCACTTATAAGTGAGATCATAGG + Intronic
1093210487 12:16302361-16302383 CCACATATGAGTGAGAACACAGG - Intergenic
1093249282 12:16781061-16781083 CCACTTATAAGTGAAAAACATGG - Intergenic
1093487026 12:19663395-19663417 CCACTTATGAGTGAGAACATGGG + Intronic
1093782834 12:23156335-23156357 CCACCTATGAGTGAGAACATGGG + Intergenic
1093807290 12:23449919-23449941 CCACCTATGAGTGAGAACATGGG - Intergenic
1093988011 12:25559270-25559292 CCACCTATGAGTGAGAACATGGG + Intronic
1093989694 12:25575915-25575937 CTACCTATGAGTGAGAACATGGG + Intronic
1094055366 12:26263908-26263930 CCACTTATAAGTGAGAACATAGG - Intronic
1094079588 12:26518284-26518306 CTCCTTATAAGTGAGAACATGGG - Intronic
1094413232 12:30190256-30190278 CCACTTACAAGTGAGAACATGGG + Intergenic
1094699641 12:32856519-32856541 CCACCTATGAGTGAGAACATGGG - Intronic
1095051594 12:37559432-37559454 CCACTTATAAGTGAGACCATGGG + Intergenic
1095432892 12:42153210-42153232 CCACAAATAAGTGAGAACATGGG - Intergenic
1095442147 12:42248098-42248120 CCACTTACAAGTGAGAACATAGG + Intronic
1095665404 12:44791343-44791365 CCACATATCAGTGAGAACATAGG - Intronic
1095680308 12:44967141-44967163 CCACAAATAAGTGAGAACATGGG - Intergenic
1095784954 12:46100143-46100165 CCATTTATAAATGAGAACATAGG - Intergenic
1095867738 12:46991549-46991571 TCACTTATATCTGAGAACATGGG - Intergenic
1096312774 12:50535923-50535945 CCACCTATGAGTGAGAATATGGG + Intronic
1096928937 12:55182781-55182803 CCACTTATAGGTGAGAACGTGGG - Intergenic
1097293431 12:57939801-57939823 CCACTTATAAGTGAGAACATGGG - Intergenic
1097340462 12:58431590-58431612 CCACTTATGAGTGAGAATATGGG - Intergenic
1097366198 12:58716064-58716086 CCACTTATAATTTAGAATAAAGG - Intronic
1097499502 12:60384438-60384460 CCACTTATAAATGAGAACATGGG - Intergenic
1097527488 12:60755683-60755705 CATCTTATAAATAAGAACACCGG - Intergenic
1097562718 12:61228284-61228306 CCACTTATAAGTAAGAACCTGGG - Intergenic
1097736212 12:63183858-63183880 CCACTTATAAGTGAGAATGTGGG + Intergenic
1098083188 12:66811856-66811878 CAGCTTAGAAGTGAGACCACAGG - Intergenic
1098347337 12:69519633-69519655 TCACTTATAAGCGAGAACATGGG + Intronic
1098878947 12:75896929-75896951 CCACTTGTAAGTGAGAGCATGGG - Intergenic
1099000537 12:77173611-77173633 CCACCTATGAGTGAGAATATGGG + Intergenic
1099276131 12:80578295-80578317 CCACCTATGAGTGAGAACATGGG + Intronic
1099382128 12:81967943-81967965 TCAGTTATGAGTGAGAACATAGG + Intergenic
1099441489 12:82705104-82705126 CCACTTATGAGTGAGAACATAGG - Intronic
1099659449 12:85536498-85536520 CCACTTAGAAGTGAAAACATGGG + Intergenic
1099721457 12:86366485-86366507 CCACTTACAACTGAGAACATAGG - Intronic
1099948473 12:89272609-89272631 CCACCTATAAGTGAGAATATGGG + Intergenic
1100087632 12:90930937-90930959 CTATTTATGAGTGAGAACATGGG - Intronic
1100101596 12:91113716-91113738 CCACTTATGAGTGAGAACATGGG + Intergenic
1100720178 12:97349631-97349653 CCACCTATGAGTGAGAACATGGG + Intergenic
1101135925 12:101742946-101742968 CCACTTATCAGTGAGGGAACTGG - Intronic
1101284349 12:103294995-103295017 CCACTTATGACTGAGAACATGGG + Intronic
1101295051 12:103413706-103413728 CCACTTATAAATGAGAACATGGG + Intronic
1101569812 12:105943311-105943333 CCACTTATAAGTGAGAACATAGG + Intergenic
1101757343 12:107631176-107631198 CCACTTACACGTGAGAACATGGG + Intronic
1102670916 12:114618135-114618157 CCACTTGTAAGAGAGAACATGGG - Intergenic
1102696139 12:114800884-114800906 CCACCTATAAGTGAGAACAGGGG + Intergenic
1103143447 12:118572516-118572538 TCAGTTATAAGTGAGAACATGGG + Intergenic
1103175181 12:118857226-118857248 CCACATATGAGTGAGAATATGGG + Intergenic
1103880313 12:124160894-124160916 CCACTTATGAGTGAGAACATAGG + Intronic
1104242309 12:127001936-127001958 CCACTTATGAGTGAGAACATAGG - Intergenic
1104344024 12:127979632-127979654 GTACTTATAAGTGAGAACATGGG - Intergenic
1104577181 12:129978177-129978199 CCACATGTAAGTGAGAACATGGG + Intergenic
1105002388 12:132699158-132699180 CCACTTATGAGTGAGAACATCGG + Intronic
1105565682 13:21545355-21545377 CCACATATCAGTGAGAATATTGG - Intronic
1105595176 13:21830701-21830723 TCACCTGTAAGTGAGAACATTGG + Intergenic
1105689353 13:22820616-22820638 CCACTTATGAGTGAGAACATGGG - Intergenic
1105689571 13:22822486-22822508 CCACTTATGAGTAAGAACACGGG + Intergenic
1106146126 13:27051378-27051400 CCACATATCGGTGAGAACATAGG + Intergenic
1106384978 13:29275596-29275618 CCATAGATAAGTGAGAACATGGG + Intronic
1107060076 13:36150834-36150856 CTACTTTCAAGTGAGAACATAGG - Intergenic
1107071707 13:36277229-36277251 CCACTTATAAGTGAGAACATGGG - Intronic
1107397843 13:40036400-40036422 TCACTTATAAGTGGGAACATTGG - Intergenic
1107578129 13:41749771-41749793 CCACCTATGAGTGAGAACATGGG - Intronic
1107639845 13:42430665-42430687 CCACCTATGAGTGAGAATATGGG - Intergenic
1108069227 13:46610548-46610570 CCACTTAGGAGTGAGAATATAGG + Intronic
1108120255 13:47178128-47178150 CCACATTTAAGTGAGACCATGGG + Intergenic
1108645454 13:52422628-52422650 CCACTTATCAGTGAGAATATGGG + Intronic
1108897505 13:55352093-55352115 CCATCTATGAGTGAGAACATGGG - Intergenic
1108967194 13:56323672-56323694 TCACTTATAAGTGAGAACATGGG - Intergenic
1109071233 13:57772018-57772040 CCACATATGAGTGAGAACAGGGG + Intergenic
1109117152 13:58402670-58402692 CCACTTATAAGTGAGACACATGG + Intergenic
1109147813 13:58803499-58803521 CCTCCTCCAAGTGAGAACACAGG - Intergenic
1109161591 13:58982061-58982083 CCACTTATGAGTGAGAACATGGG + Intergenic
1109400945 13:61827936-61827958 CCACCTATGAGTAAGAACATGGG + Intergenic
1109432088 13:62249523-62249545 CCACTTATGAGCGAGAACATAGG - Intergenic
1109496694 13:63180950-63180972 CCACCTATGAGTGAGAACATCGG + Intergenic
1109625338 13:64966804-64966826 CCACTTATAAGTGAGGACATGGG - Intergenic
1109640984 13:65191426-65191448 CCACTTATGAGGGAGAACATGGG + Intergenic
1109707902 13:66122814-66122836 TCACTTATAAGAGGGAACATGGG + Intergenic
1109915546 13:68981017-68981039 CCACTTATAAGAGAGAACATAGG - Intergenic
1109927461 13:69163095-69163117 CCACAAGTAAGTGAGAACATGGG + Intergenic
1110157866 13:72340977-72340999 CAACATATGAGTGAGAACATAGG - Intergenic
1110334643 13:74313329-74313351 CCACTTATAAGTGAGAACATAGG + Intergenic
1110524891 13:76524976-76524998 CCACTTATAAGTGAGGACATAGG - Intergenic
1110766267 13:79282751-79282773 CCACTGATAAGTGATAGCATTGG + Intergenic
1110830377 13:80024436-80024458 CAACTAATAAGTGAGAAACCTGG + Intergenic
1111101423 13:83593252-83593274 ATACTTATAAGTGAGAACATGGG + Intergenic
1111169944 13:84513225-84513247 CCACGTATGAATGAGAACATAGG + Intergenic
1111489368 13:88951020-88951042 CCACTTATAAGTGAGACCATAGG - Intergenic
1111712598 13:91835650-91835672 CCACTTATGAGTGAGAACACGGG - Intronic
1111727586 13:92032198-92032220 CCACTTGTGAGTGAGAACATAGG - Intronic
1111747600 13:92290559-92290581 CCACTTATGAGGGAGAACATAGG + Intronic
1111861699 13:93715374-93715396 CCACTAACAAGTGAGAATATTGG - Intronic
1112080644 13:95966306-95966328 CCACTTACGAGTGAGAACACAGG - Intronic
1112082793 13:95993159-95993181 TCACTTATAAGTGAGAACACAGG - Intronic
1112139671 13:96624673-96624695 CCACTTATAAGTGAGACATGTGG + Intronic
1112244720 13:97721397-97721419 AAACTTATAAGTGAAAACATAGG + Intergenic
1112250656 13:97775894-97775916 CCAGTTATGAGTGAGGACATAGG + Intergenic
1112966262 13:105198987-105199009 CCACTTATGGGTGAGAACATAGG + Intergenic
1112983991 13:105423440-105423462 TCACTTGTAAGTGGGAACTCTGG + Intergenic
1113358598 13:109607259-109607281 TCACTTATAAGTGAGAACATGGG + Intergenic
1114042473 14:18691734-18691756 TCACTTGTAAGTAAGAACATAGG - Intergenic
1114127161 14:19742016-19742038 CCACAAATAAGTGAGAATATGGG - Intronic
1114135246 14:19840780-19840802 CTGCATATAAGTGAGAACACGGG - Intergenic
1114154545 14:20085610-20085632 CCACATATAAGTGAGATCATGGG - Intergenic
1114390382 14:22301956-22301978 CCACTTCTAAGTGAGAACACAGG - Intergenic
1114762891 14:25336775-25336797 CTACATATGAGTGAGAACATGGG - Intergenic
1115182383 14:30644074-30644096 CCACTTACAAGTGAGAACATAGG + Intronic
1115294020 14:31805671-31805693 CCACTTATAAGTGAGAACATGGG - Intronic
1115371378 14:32618422-32618444 CCACTTACAAGTGAGGACAGAGG + Intronic
1115700057 14:35944327-35944349 CCACTTATAAGTGAGAACATTGG + Intergenic
1115923588 14:38406114-38406136 CCTCTTATAAACAAGAACACAGG - Intergenic
1115931307 14:38498516-38498538 CCAGTTATAAATGACCACACAGG + Intergenic
1115947542 14:38679046-38679068 CCACATATGACTGAGAACATTGG + Intergenic
1116088047 14:40266702-40266724 CCACCTATGAGTGAGAATATGGG - Intergenic
1116149081 14:41115673-41115695 CCACTTATGAGTGAGAAGATGGG - Intergenic
1116153171 14:41167812-41167834 CCACTTATAAGTGAGAATATGGG + Intergenic
1116424673 14:44775919-44775941 CCACTTGTAAGTGAGAACATGGG - Intergenic
1116704519 14:48280121-48280143 CCACCTATCAGTGAGAACATGGG + Intergenic
1117173174 14:53121691-53121713 CCACTTTTGACTGAGAACATGGG - Intronic
1117317378 14:54585666-54585688 CCACATATGAGTGAGAACATAGG + Intronic
1117474403 14:56079170-56079192 CTGCTTATAAGGGAGAACAGGGG - Intergenic
1117641603 14:57805535-57805557 CCACTTACAAGTAAGAACATGGG - Intronic
1117812019 14:59557382-59557404 CCACCTATGAGTGAGAACATGGG - Intronic
1117971062 14:61251428-61251450 CCACAAATAAGTCAGATCACGGG + Intronic
1118097329 14:62552167-62552189 CCATTTATAAGTGAGAACATGGG - Intergenic
1118100594 14:62597009-62597031 CCACTTATAAGTGAGGACAATGG - Intergenic
1118142861 14:63103781-63103803 CCACTTATAAGTGACAACACAGG + Intergenic
1118263618 14:64271639-64271661 CCACAAATAAGTGAGAACATGGG + Intronic
1118420906 14:65602202-65602224 CCACTTATGAGTGAGAACATAGG + Intronic
1118531209 14:66707581-66707603 CCACTTAAGAGTGAGAACATGGG - Intronic
1118682638 14:68259248-68259270 CCACCTGTGAGTGAGGACACAGG + Intronic
1119874931 14:78050750-78050772 CCACTTGTAAGTGAGAACATGGG + Intergenic
1120331783 14:83102610-83102632 CCACATGTAAGTGAGAACATGGG - Intergenic
1120422726 14:84308703-84308725 CCACTTATAAGTGAGAACATGGG - Intergenic
1120451047 14:84667264-84667286 CCACATATGAGTGAGAATAAGGG + Intergenic
1120703320 14:87722686-87722708 CTTTTTATAAGTGAGAAAACTGG - Intergenic
1120838571 14:89062988-89063010 CCACTTCTGAGTGGGACCACAGG - Intergenic
1121156229 14:91687418-91687440 CCTCTTATAAAAGAGAACCCAGG + Intronic
1121700919 14:95953462-95953484 CCCCTTACAGGTGAGGACACAGG + Intergenic
1122434105 14:101680972-101680994 CCACTTACGAGTGAGAACATGGG + Intergenic
1123148602 14:106158729-106158751 CCACTTACGAGTGAGAACAGTGG + Intergenic
1123796164 15:23772929-23772951 CTACTTATAAGTGAGAACACAGG + Intergenic
1124147808 15:27144728-27144750 TCAGTCATAAGTGAGAGCACAGG - Intronic
1124266825 15:28243424-28243446 ACACTTTTAAGTGACTACACAGG + Intronic
1124557608 15:30741769-30741791 CCACATATCAGTGAGAACATAGG - Intronic
1125218200 15:37303504-37303526 CCACCTATGAGTGAGAATATGGG + Intergenic
1125260337 15:37816906-37816928 CCACGTACAAGTGAGAACATGGG - Intergenic
1126897920 15:53279731-53279753 CCACTTATGAGTGAGAACATGGG + Intergenic
1126907217 15:53380801-53380823 CCACCTATGAGTGAGAATATGGG + Intergenic
1126928718 15:53622540-53622562 CCACTTATAAATTAGGACATGGG - Intronic
1126966528 15:54060883-54060905 CCACCTATGAGTGAGAACTGCGG - Intronic
1126996974 15:54455031-54455053 CCACTTATAAGTGAGAACATAGG + Intronic
1127030588 15:54857334-54857356 CCACTTATGCGTGAGAACATGGG - Intergenic
1127034818 15:54904217-54904239 CCACTTGTAAGTGAGAAATGTGG + Intergenic
1127090885 15:55465864-55465886 CCATTTATGAGTGAGAACATGGG - Intronic
1127125570 15:55808543-55808565 CCACCTGTGAGTGAGAACATAGG - Intergenic
1127134581 15:55906548-55906570 CCACCTATGAGTGAGAACATGGG - Intronic
1127212633 15:56789843-56789865 CCACTTATGAGTGAGAACATGGG - Intronic
1127474593 15:59321597-59321619 CCACTTTTAAGTGAGAACATAGG - Intronic
1127565961 15:60188557-60188579 CCACCTATGAGTGAGAACATGGG - Intergenic
1127814517 15:62595817-62595839 CCACATGTAATTAAGAACACGGG - Intronic
1128596932 15:68960837-68960859 CCACTTATAAGTGAGAACATAGG + Intronic
1129089433 15:73133314-73133336 CCACTTATGAGTGAGAACATAGG - Intronic
1129444186 15:75604946-75604968 CCAATTATGAGTGAGAACATAGG + Intronic
1129593970 15:76944597-76944619 CCACAAATGAGTGAGAACATGGG + Intronic
1130030582 15:80310076-80310098 CCACTTATGAGTGAGAATATGGG - Intergenic
1130311168 15:82756115-82756137 ACACTTATAGATGAGAAAACTGG + Exonic
1130845209 15:87737528-87737550 CCGCTTATGAGTGAGAACATAGG + Intergenic
1131283879 15:91041827-91041849 CCACATATGAGTGAGATCATGGG + Intergenic
1131572346 15:93551944-93551966 CCACTTATGAGTGAGAACAAGGG - Intergenic
1131658793 15:94491559-94491581 CCGCATATGAGTGAGAACATAGG - Intergenic
1132442340 15:101880497-101880519 CCATTTATGAGTGAGAACATTGG + Intergenic
1133697337 16:8277319-8277341 CCATTTAAAAGTGAGGAAACTGG - Intergenic
1134406343 16:13962317-13962339 CCACAAATAAATGAGAACACAGG + Intergenic
1134793916 16:17016920-17016942 CCACAAATGAGTGAGAACATGGG + Intergenic
1134905259 16:17974419-17974441 CCACTTATAAGTGAGAACATGGG - Intergenic
1135298817 16:21306798-21306820 CCATTTATGAGTGAGAACATGGG + Intergenic
1135346183 16:21690419-21690441 CCACTTACAAGTGAGAACATGGG + Intronic
1135524821 16:23206210-23206232 CCACTGAAATGTGAGAACAATGG + Intronic
1135857317 16:26023829-26023851 CAACTTATAAGTGACAAGCCAGG - Intronic
1136729309 16:32393209-32393231 CCACTTATAAGTGAGAATATGGG + Intergenic
1136781925 16:32910408-32910430 CCACTTACGAGTGAAAACAGCGG - Intergenic
1136887868 16:33943440-33943462 CCACTTACGAGTGAAAACAACGG + Intergenic
1137317696 16:47344796-47344818 CCACATGTAAGTGAGAACATGGG + Intronic
1137457880 16:48631968-48631990 CCACTTATAAGTAAGAACATGGG - Intergenic
1137506707 16:49060261-49060283 CCACTTATAAGTGAAAAATATGG + Intergenic
1137828616 16:51522683-51522705 CCACTTATGGGTGAAAACATGGG - Intergenic
1137975499 16:53028089-53028111 CCACTCGTAAGGAAGAACACAGG - Intergenic
1138712490 16:58985772-58985794 CAGCTTCTAAGAGAGAACACTGG + Intergenic
1138882195 16:61030380-61030402 TCACTTCTAAGTGAAAACATGGG + Intergenic
1139113726 16:63923796-63923818 TCACTTGTAAATGAGAACATGGG - Intergenic
1139117953 16:63979651-63979673 CCACTTATGAGTGAGAACATGGG + Intergenic
1139247624 16:65461823-65461845 CCACATATCAGTGAGAACATAGG - Intergenic
1139986358 16:70901490-70901512 CCACTTCCAAGTGAGAACATGGG + Intronic
1140170359 16:72598481-72598503 TCACTTATAAGTGAGAACATAGG - Intergenic
1140258885 16:73360059-73360081 CAACTAATAAGTGATAACTCAGG - Intergenic
1140333006 16:74076095-74076117 CCACCTATAAGCGAGAAGATGGG - Intergenic
1140391693 16:74592603-74592625 CCATTTATAAATAAGAAAACTGG + Intronic
1140547842 16:75828351-75828373 CCACATATGAGTGAGAATATAGG + Intergenic
1140597095 16:76429472-76429494 CCATTTATTAGAGAGAAAACTGG + Intronic
1140685412 16:77429349-77429371 CCACTTATAAGTGAGAACGTGGG - Intronic
1140687275 16:77445502-77445524 TCACTGATAGGTGAGATCACTGG + Intergenic
1140993683 16:80239731-80239753 CCACTTATGAGTGAGAACATGGG + Intergenic
1141348732 16:83273428-83273450 CCACTTATAAGTGAGAACAAGGG + Intronic
1142300417 16:89254554-89254576 CCACTTATGAGTGAGAAAATGGG + Intergenic
1202997087 16_KI270728v1_random:124312-124334 CCACTTATAAGTGAGAATATGGG - Intergenic
1203023774 16_KI270728v1_random:436654-436676 CCACTTATAAGTGAGAATATGGG - Intergenic
1203084581 16_KI270728v1_random:1174398-1174420 CCACTTACGAGTGAAAACAGCGG - Intergenic
1143231787 17:5362310-5362332 CCATTTACAGGTGAGAAAACTGG + Intronic
1143434984 17:6917389-6917411 CCACTTATGAGTGAGAATATAGG - Intronic
1144052763 17:11511201-11511223 CCACTTATGAGTGAGAACATGGG - Intronic
1145202673 17:20960820-20960842 CCACCTATAAGTGAGAACATGGG + Intergenic
1146200176 17:30850592-30850614 CCACATAAGAGTGAGAACATGGG + Intronic
1146969097 17:37057986-37058008 CCACGTATAATTGAGATCAGGGG - Intergenic
1148011080 17:44482135-44482157 CCACTTAAGAGTGAGAACATGGG - Intronic
1148969740 17:51469443-51469465 CCATTTATTAGTGAGAATATGGG - Intergenic
1149092526 17:52801302-52801324 CCACTTATAAGTGATAGTATGGG + Intergenic
1149220492 17:54411591-54411613 CCACTTATAAGTGAGAACATGGG - Intergenic
1149409462 17:56390272-56390294 CAACTTATGAGTGAGAACATGGG + Intronic
1150026268 17:61677729-61677751 CCACCTATGAGTGAGAACACGGG - Intergenic
1150090938 17:62324179-62324201 CCACTTATGAGGGAGAACATGGG - Intergenic
1150459703 17:65339029-65339051 CTACCTATAATTGAAAACACAGG + Intergenic
1150524335 17:65906183-65906205 CCACTTATGAGTGAGAACATGGG - Intronic
1150639452 17:66939643-66939665 GCAAATATAAGTGAGAAGACTGG - Intergenic
1150766509 17:68006435-68006457 CCACTTATGAGTGAGAACGTAGG + Intergenic
1151004426 17:70417348-70417370 CCATTTATAAGTAAGAACATAGG - Intergenic
1153142325 18:1987499-1987521 TCATTTATAAGTGAGAACATGGG - Intergenic
1153350823 18:4079450-4079472 CTACTTATAAGTGAGAATACAGG - Intronic
1153450892 18:5227351-5227373 CCACATATGAGTGAGAACATAGG + Intergenic
1153548071 18:6230307-6230329 CCACTTGCAAGTGAGAACATGGG + Intronic
1154098987 18:11450982-11451004 CCACTTATAAGTGAGACATGTGG - Intergenic
1154387492 18:13908288-13908310 CCACATGTGAGTGAGAACAAGGG - Intronic
1155018996 18:21877461-21877483 CCACATATGAGTGAGAACATTGG - Intergenic
1155070600 18:22312653-22312675 CCACTTATAAGTGAGAACATAGG - Intergenic
1155363739 18:25030080-25030102 TCACTTACAGGTGAGAACATGGG - Intergenic
1155641311 18:28019061-28019083 CCACTTATGAGCGAGAACATAGG - Intronic
1156280587 18:35633460-35633482 CCACCTATGAGTGAGAACATGGG - Intronic
1157170206 18:45396893-45396915 CCACTTATAAGTGATAAATGTGG + Intronic
1157406694 18:47427761-47427783 CCAGTTATAACTGAGAAAATAGG - Intergenic
1157698169 18:49741293-49741315 CTACTTATAAGTGAGAAATGTGG + Intergenic
1158338066 18:56434962-56434984 CTACTTATAAATGAGAATATAGG + Intergenic
1158729360 18:60005082-60005104 CCACTTATGAGTGAGAACATAGG + Intergenic
1158902550 18:61979379-61979401 CCACTCGTAAGTGAGAACATGGG + Intergenic
1160127304 18:76187987-76188009 CCACATATAAGTGAGATCATAGG + Intergenic
1160138872 18:76300924-76300946 CCACTTGTAAGTGAGAAACGTGG - Intergenic
1160429650 18:78802641-78802663 CCACTTATGAGTGAGAACATGGG + Intergenic
1160642597 19:152656-152678 CCATTTATGAGTGAGAACATCGG - Intergenic
1160962065 19:1726528-1726550 CCACTGATAAGCGAGAACATGGG - Intergenic
1161587188 19:5111951-5111973 CCACTTAAAAATGTGAACATTGG + Intronic
1161926086 19:7300989-7301011 CCACATAGGAGGGAGAACACGGG + Intergenic
1161927081 19:7309054-7309076 CCACTTATCAATGAGAACATAGG - Intergenic
1163869246 19:19804849-19804871 CCACCTATGAGTGAGAACATGGG - Intronic
1164150809 19:22549024-22549046 CCACTTATAAGTGAGAATGTGGG - Intergenic
1164435126 19:28222246-28222268 CCACTTAGAAGTGATAACTGAGG - Intergenic
1164488584 19:28685367-28685389 CCACCTATGAGTGAGAACATGGG - Intergenic
1164677904 19:30114185-30114207 CCACTTACGAGTGAGAACATAGG + Intergenic
1165291471 19:34889556-34889578 CCACTTAATAATGAGAACAGGGG + Intergenic
1165683561 19:37798422-37798444 CCACTTATAAGTGAGAACATAGG - Intronic
1165699639 19:37927582-37927604 CCACTTAGAAGTAAGAACATGGG + Intronic
1165699651 19:37927771-37927793 CCACTTAGAAGTAAGAACATTGG + Intronic
1166186853 19:41145357-41145379 CCACTTATAAGTGAGAACATAGG + Intergenic
1166969018 19:46549940-46549962 CCACTTATAAGTGAGAACACGGG + Intronic
1167390645 19:49192592-49192614 TTACTTATAAGTGAGAACATGGG - Intronic
1167708503 19:51096252-51096274 CCACATATCAGTGAGAACATAGG - Intergenic
1167862056 19:52293040-52293062 CCACCTATGAGTGAGAACATGGG + Exonic
1167865676 19:52325682-52325704 CCACTTATAAGTGAGAACATGGG - Exonic
1167986448 19:53321840-53321862 CCACATATGAGTGAGAACATGGG + Intergenic
1168302341 19:55413000-55413022 CCACTTATAAGTGAGAACATAGG - Intergenic
1168362372 19:55752857-55752879 TCACGTATAAGTGAGACCATGGG - Intergenic
1168712461 19:58509724-58509746 CTTCTCAAAAGTGAGAACACAGG + Intronic
925339989 2:3129543-3129565 CCACTTATGAGTGAGAACATGGG - Intergenic
925553960 2:5107890-5107912 CCACCTATGATTGAGAACATGGG + Intergenic
925898328 2:8490050-8490072 CCACTTATAGGTGAAATCACAGG + Intergenic
926733752 2:16057215-16057237 CCACTTATAAGTGAGAATATGGG + Intergenic
926804579 2:16695173-16695195 CCACTTGTAAGTGAGAACATAGG + Intergenic
927590949 2:24357392-24357414 CCACTTATGAGTGAGAACATAGG - Intronic
928214118 2:29347130-29347152 CCATTTATAGATGAGAAAACTGG + Intronic
928472432 2:31587663-31587685 CCACTTATGAGTGAGAACATGGG - Intergenic
928497029 2:31843501-31843523 CCATTTATTAGTGAGAACATGGG - Intergenic
928711946 2:34017217-34017239 TCACTTATAAGTGAGAACACAGG - Intergenic
928765556 2:34641232-34641254 CCACCTATGAGTGAGAACATGGG - Intergenic
928776085 2:34765498-34765520 CCACTTATAAGTGAGAACATGGG - Intergenic
928801126 2:35093709-35093731 TCACTTATAAGTGAGAACATAGG - Intergenic
928894458 2:36244494-36244516 CCACTTACAAGTGAGAACATGGG + Intergenic
929067132 2:37989347-37989369 CCAGTTATAGATGAGAAAACTGG + Intronic
929082267 2:38132633-38132655 CCACCTATGAGTGAGAACATGGG + Intergenic
929267653 2:39937363-39937385 CCACTTATAGGTGAAAATAATGG - Intergenic
929718269 2:44336451-44336473 CCACTTATAAGTGAGAACATGGG - Intronic
929804279 2:45131038-45131060 CAATCTATAAATGAGAACACAGG - Intergenic
930271953 2:49267731-49267753 CCACTAATGAGTGAGAACATGGG - Intergenic
930440407 2:51397389-51397411 CCACTTTTGAGTGAGAGCATGGG - Intergenic
930606951 2:53502586-53502608 CCACCTATAAGTGAGAACATGGG + Intergenic
930672421 2:54164935-54164957 CCGCTTATGAGTGAGAACTTGGG + Intronic
930676990 2:54213166-54213188 CCATTTTTAAGAGAGAACATTGG + Intronic
930916300 2:56692942-56692964 CCACTTGTAAGTGAGAACAAAGG - Intergenic
930928808 2:56855311-56855333 CCATTTATAAGTGAGAATAAGGG + Intergenic
930993825 2:57692014-57692036 CCACTTACAAGTGAGAACATGGG - Intergenic
931151640 2:59580755-59580777 CCACTTATAAGTGAGAACATGGG - Intergenic
931478599 2:62616635-62616657 CCACTTATGAGTGAGAACATGGG + Intergenic
931539881 2:63318679-63318701 CCACTTATAAGAGAGAACATGGG - Intronic
931546571 2:63394802-63394824 CCACGTATAAGTGAGAAATGTGG - Intronic
931568389 2:63641045-63641067 CCACAAATAAATGAGAACATGGG + Intronic
932087239 2:68773416-68773438 CCACTTATAAATAAGAACATGGG - Intronic
932506963 2:72243509-72243531 CCACCTATGAGTGAGAACATGGG - Intronic
932524275 2:72446536-72446558 CCACTTACAAGTGAGAACATGGG - Intronic
932532976 2:72557563-72557585 CCACTTATAAGTGAGAACATGGG - Intronic
932871168 2:75399858-75399880 TAACTTACAAGTGAGAACACAGG - Intergenic
932908357 2:75779128-75779150 CCACTTATAAGTTAAAACATTGG - Intergenic
933061962 2:77749155-77749177 CCACTTATGAGTGAGAACATGGG - Intergenic
933097736 2:78209051-78209073 TCACTTATAAGTGAGAGCAAGGG + Intergenic
933541989 2:83656750-83656772 CCATTTTTAATTAAGAACACAGG - Intergenic
933556739 2:83839410-83839432 CCACCTATGAGTGAGAATATGGG + Intergenic
933644677 2:84801012-84801034 CCACCTATGAGTGAGAATATGGG - Intronic
934185609 2:89671120-89671142 CCACTTATAAGTGAGAATATGGG + Intergenic
934316828 2:91929397-91929419 CCACTTATAAGTGAGAATATGGG - Intergenic
934617594 2:95784373-95784395 CCACCTATGGGTGAGAACATGGG - Intergenic
934643299 2:96040186-96040208 CCACCTATGGGTGAGAACATGGG + Intergenic
934990576 2:98917852-98917874 TCATTTATAAGTGAGAACATGGG + Intronic
935081757 2:99804847-99804869 CCACTTCTAAATGAGAATATAGG - Intronic
935190408 2:100773518-100773540 CCACTTTCAAATGAGAACCCAGG - Intergenic
935266528 2:101399760-101399782 CCCCTTATTAGATAGAACACTGG - Intronic
935749467 2:106218361-106218383 CCACAAATAAGTGAGAACATGGG - Intergenic
936121827 2:109752952-109752974 CCACAAATAAGTGAGAATATGGG + Intergenic
936222868 2:110618520-110618542 CCACAAATAAGTGAGAATATGGG - Intergenic
936517236 2:113189134-113189156 CCACTTATGAGTGAGAACATAGG + Intronic
936733389 2:115410394-115410416 CCACTTATAACTGAGAACATGGG - Intronic
936781584 2:116039432-116039454 CCACCTATGAGTGAGAACATGGG - Intergenic
936784275 2:116074431-116074453 CCACTTAAAAGTGAGAACGTGGG + Intergenic
936889035 2:117347812-117347834 TCACTTATAACTGAGAACATGGG - Intergenic
936903409 2:117510156-117510178 TCACTTATAAGTGGGAACTAAGG + Intergenic
937376155 2:121337145-121337167 CAACTGATCAGTGAGAACAGTGG - Intergenic
937550248 2:123079507-123079529 CCACTTATAAGTGAGAACATGGG + Intergenic
937587822 2:123576161-123576183 CCACAAACAAATGAGAACACGGG - Intergenic
937694211 2:124789630-124789652 CCACTTATAAATGAGAATATGGG + Intronic
937813187 2:126221379-126221401 CGACTTATGAGTGAGAACATGGG + Intergenic
938223989 2:129599511-129599533 CCACTTATGAATGAGAACATAGG + Intergenic
938476003 2:131614151-131614173 CCACCTATGAGTGAGAACATGGG + Intergenic
938597766 2:132806001-132806023 TCACATATCAGTGAGAACATAGG + Intronic
939472370 2:142639745-142639767 CCACTTACAAATGAGAACATGGG + Intergenic
939552123 2:143628054-143628076 CCACTTATAAGAAAGAACATGGG + Intronic
939794122 2:146619966-146619988 CCACATATAAGTGAGATAATGGG - Intergenic
940208709 2:151234286-151234308 TCACTTATAAGTGAGAACATAGG - Intergenic
940257744 2:151749248-151749270 CCACGTATGAGTGAGAAGATGGG - Intergenic
940409032 2:153338383-153338405 CAACTAATAAGTGATAAAACTGG + Intergenic
940431209 2:153592608-153592630 CCATTTATGAGTGAGAACATAGG - Intergenic
940503212 2:154520631-154520653 CCACAAATAAGTGAGAACATGGG + Intergenic
940545492 2:155078456-155078478 CCACTTACAAGTGAGAACAGCGG - Intergenic
941056544 2:160796079-160796101 CCACCTATGAGTGAGAACTGTGG - Intergenic
941237673 2:162995477-162995499 GCACTTGTGAGTGATAACACTGG + Intergenic
941427632 2:165368376-165368398 CAACATTTAAGTGAGAAAACAGG + Intronic
941590167 2:167410192-167410214 CCACTTATGAGTGAGAAGAATGG - Intergenic
941745647 2:169084065-169084087 TCACAAATAAGTGAGAACATGGG + Intronic
942213463 2:173694822-173694844 CCACTTACAAGTGAGAACATAGG - Intergenic
942421698 2:175814551-175814573 TCACTTATAAGTGAGAACATGGG - Intergenic
942430455 2:175905895-175905917 TCAATTACAAGTGAGAACATGGG + Intergenic
942574981 2:177353685-177353707 CCACATATCAGTGAGAACACAGG + Intronic
942721581 2:178959059-178959081 CCACCTATGAGTGAGAACATGGG - Intronic
942755131 2:179331729-179331751 TCACTTATAAGTGGGAACATTGG + Intergenic
942762855 2:179420391-179420413 CCACTTATAAGCAAGAACATGGG - Intergenic
943029101 2:182665982-182666004 CTATTTATAAGTGAGAACATGGG - Intergenic
943031626 2:182692435-182692457 CCACCTATGAGTGACAACATGGG - Intergenic
943227083 2:185191401-185191423 CTGCTTATGAGTGAGAACATGGG + Intergenic
943422214 2:187680365-187680387 TGACTTACAAGTGAGAACATTGG - Intergenic
943544033 2:189252528-189252550 CCACCTGTGAGTGAGAACATGGG - Intergenic
943600880 2:189919616-189919638 CCACTTATGAGTAAGAACATGGG + Intronic
943606079 2:189978318-189978340 CCACTTATAAGTGAAAATTTGGG + Intronic
944090771 2:195908504-195908526 CCACTTATGAGTGAGAACATGGG + Intronic
944164559 2:196704775-196704797 CCACCTATGAGTGAGAACATGGG + Intronic
944269476 2:197765096-197765118 CCACTTATGAGTGAGAACATAGG - Intronic
944334077 2:198508710-198508732 CCACTTATGAGTGAGAACATAGG + Intronic
944386732 2:199173564-199173586 CCACTTTTAAGTGAGAACATAGG - Intergenic
944936786 2:204577866-204577888 TCATTTAAAAGTGAGAAAACTGG - Intronic
945075646 2:206036498-206036520 CCACATATCAGTGAGAACATAGG - Intronic
945313813 2:208348138-208348160 ACACTGACAAGTGAGAACAGAGG - Intronic
945374889 2:209068173-209068195 CCACATATAAGTAAGTACACGGG - Intergenic
945520992 2:210827093-210827115 CCACTTATAAGTGGAAACTTGGG + Intergenic
945727277 2:213487064-213487086 CCACATATAAGTGTGAACTTAGG - Intronic
946518416 2:220438996-220439018 CCACAAATAAGTGAGAACGTGGG + Intergenic
946617222 2:221523132-221523154 TCACTTACAAAAGAGAACACTGG + Intronic
946622834 2:221577129-221577151 CCACATATCAGTGAGAACTTAGG + Intergenic
947103674 2:226647304-226647326 CCACTTACAAGTGAGAACATAGG + Intergenic
947896430 2:233678082-233678104 CCATTTCTAAGTGAAAACAATGG - Intronic
948046416 2:234949114-234949136 CCACTTCAAGGTGAGAACACTGG + Intergenic
948669864 2:239561372-239561394 CCACTTATAATTGAGGACATAGG + Intergenic
1169498830 20:6139727-6139749 CCATTTATGAGTGAGAACATGGG + Intergenic
1169936286 20:10887000-10887022 CCACTTATGAGTGAGAACATGGG + Intergenic
1169938815 20:10915023-10915045 CCACTTATGAGTGAGAAGATGGG - Intergenic
1169983885 20:11420481-11420503 CCATTTATGAGTGAGAACATGGG + Intergenic
1170047338 20:12099453-12099475 CCAGTTATAAGTGAGAACATGGG - Intergenic
1170160328 20:13303979-13304001 CCACCTCTAAGTGACAACCCAGG + Intergenic
1170179944 20:13519092-13519114 CCACATATAAGTGAGAATATAGG - Intronic
1171198103 20:23217272-23217294 TCACTTATGAGTGAGAACAGAGG + Intergenic
1171247684 20:23625842-23625864 CCACTGAGAAGTGAGCCCACAGG + Intergenic
1171360564 20:24583797-24583819 CCACTTACAAGTGAGAACATGGG - Intronic
1171546131 20:26002979-26003001 CCACTTATAAGTGAGACCATGGG + Intergenic
1171818302 20:29808717-29808739 CCACAAATAAGTGAGAACATGGG + Intergenic
1171937789 20:31292533-31292555 CCACTTATAAGTGAGAACATAGG - Intergenic
1172089669 20:32420985-32421007 CCATTTATGAGTGAGAACATGGG - Intronic
1172414707 20:34755607-34755629 CCACTTATCATTTACAACACAGG + Intronic
1172799978 20:37568920-37568942 CCGCTTATAATTGAGAACATGGG + Intergenic
1172840253 20:37898579-37898601 CCATTTATAAGGGGGAACAATGG - Intergenic
1172875103 20:38159273-38159295 CCACTTATAAGTGAGAACATGGG - Intronic
1173192417 20:40886705-40886727 CCACTTACCAGTGAGGAAACAGG - Intergenic
1173773951 20:45687223-45687245 CCACTTATAAGGGAGAACATGGG + Intronic
1173913799 20:46690971-46690993 CCTCATATAAGTGAGATCATGGG + Intergenic
1174886184 20:54337828-54337850 CCACTTATAAGTGAGAAAAATGG - Intergenic
1175292531 20:57886083-57886105 CCACTTGTAAGTGAGAATATAGG + Intergenic
1175343775 20:58254452-58254474 CCATTTATAAGTGAGAACATGGG - Intergenic
1175558776 20:59898484-59898506 CCACTTATGAGTGAGAACATGGG - Intronic
1175680135 20:60980972-60980994 CCGCAAATAAGTGAGAACATGGG - Intergenic
1175860531 20:62147933-62147955 CCACTTCTGAGGGAGCACACAGG - Intronic
1176720355 21:10387780-10387802 CCTCTTATGAGTGAGAACATGGG - Intergenic
1176814769 21:13588598-13588620 CTGCATATAAGTGAGAACATGGG + Intergenic
1176934583 21:14851361-14851383 CCACTTATAAGTGAGAACATGGG + Intergenic
1177017126 21:15805761-15805783 CCAATTATATGTGAAAATACTGG - Intronic
1177105687 21:16952807-16952829 CCACAAATAAATGAGAACATGGG - Intergenic
1177313727 21:19430066-19430088 CCACTTATGAATGAGAACATGGG - Intergenic
1177974567 21:27830945-27830967 CACCTTACAAGTGAGAACATGGG + Intergenic
1178141012 21:29683539-29683561 TCACTTATAAGTAAGATCATGGG - Intronic
1178802475 21:35809020-35809042 CCACTTATAAGTGAGACCATGGG - Intronic
1178808444 21:35859239-35859261 CCACAAATGAGTGAGAACATGGG - Intronic
1179781704 21:43705132-43705154 CCACTTGTAACTGAGAGCATGGG - Intergenic
1180543167 22:16471806-16471828 CCACTTATAAGTGAGAATATGGG - Intergenic
1181451077 22:23021740-23021762 CCACTTATTAGTGAGAACATGGG + Intergenic
1181913589 22:26260362-26260384 CCACTTATGAGTAAGAACATAGG + Intronic
1182992272 22:34779313-34779335 CCACCTATGAGTGAGAATATGGG + Intergenic
1183752844 22:39731936-39731958 CCACAGACAAGTGAGTACACCGG + Intergenic
1184934017 22:47705740-47705762 CCACTCCTAAGTGAAAACCCAGG - Intergenic
949101457 3:150592-150614 CCACTTATAAGTGAGAACATGGG + Intergenic
949109347 3:239820-239842 CCACTTAAGAGTGAGAACATAGG + Intronic
949958188 3:9287520-9287542 CCACTTCTAAGTGAGAACATGGG - Intronic
950342040 3:12256091-12256113 GCTCTCATAAGTGAGAACACAGG + Intergenic
950619140 3:14189027-14189049 TCACTTATGAGTGAGAACATGGG + Intronic
950653350 3:14421725-14421747 CCATTTACAGGTGAGAAAACTGG + Intronic
951144130 3:19206037-19206059 CCATTTAGGAGTGAGAACACAGG + Intronic
951156135 3:19355649-19355671 CCACCTACGAGTGAGAACATGGG - Intronic
951184325 3:19694673-19694695 CCACTTATGAGTGAGAACATAGG - Intergenic
951238799 3:20266073-20266095 CCACTTAGGAGTGAGAAACCTGG + Intergenic
951380251 3:21975319-21975341 CCACCAATAAGTGAGAACATAGG - Intronic
951394768 3:22152080-22152102 CCACTTCTAAGTGAGAACACAGG + Intronic
951585338 3:24209591-24209613 CCACCTTTGAGTGAGAACATGGG - Intronic
951998096 3:28754221-28754243 CCACTTATAAGTGAAAACACAGG - Intergenic
952085508 3:29815700-29815722 CCACTTATAAGTGAGAACAAAGG - Intronic
952364377 3:32662003-32662025 CCACATACAAGTGAGATCATGGG - Intergenic
952658412 3:35815886-35815908 TCACTTATGGGTGAGAACATGGG + Intergenic
952847151 3:37697560-37697582 CCACCTATGAGTGAGAACATGGG + Intronic
953081233 3:39620459-39620481 CTACTTATAAATGAAAACATAGG - Intergenic
953087803 3:39689142-39689164 CCACAAATAAGTGAGACCATGGG - Intergenic
953107505 3:39898657-39898679 CCATTTACAAATGAGAAAACAGG - Intronic
953822519 3:46220768-46220790 CCACTTATAGGTGAGACCATAGG - Intronic
953844250 3:46414725-46414747 CCACCTATGAGTGAGAACATGGG + Intergenic
953864250 3:46570801-46570823 CCACAAAGAAGTGAGAACATGGG - Intronic
954632403 3:52054804-52054826 CCTCTTATAGATGAGACCACAGG + Intronic
954960314 3:54558644-54558666 CCACTTATAAGTGAGAACATAGG + Intronic
956071787 3:65460773-65460795 CCACTTATAAGTGAGAACATGGG + Intronic
956136078 3:66100357-66100379 CCACTTACAAGTGAGAACATGGG + Intergenic
956231598 3:67022734-67022756 CCACTTATAAGTGACAACATGGG - Intergenic
956578014 3:70777361-70777383 CCACTTATGAGTGGGAACACAGG - Intergenic
957759985 3:84542905-84542927 CCACTAACAATTGAGAACATGGG + Intergenic
957777327 3:84770356-84770378 CCTCTTATAAGTGAGAAAATGGG - Intergenic
958014284 3:87920166-87920188 CCACTTATGAGTGAGAATGTAGG - Intergenic
958035566 3:88166294-88166316 ACACATTTAAGAGAGAACACTGG - Intronic
958467664 3:94477694-94477716 CCACTTATGAGTCAGAACATAGG - Intergenic
958770156 3:98416379-98416401 CCACTTACAAGTGAGAATATGGG - Intergenic
959034615 3:101346672-101346694 CCACTTATAACTGAGAACATGGG - Intronic
959239155 3:103766584-103766606 CCACTTATGAGTGAGAACACAGG - Intergenic
959450421 3:106492349-106492371 CCACCAATGAGTGAGAACATGGG + Intergenic
959863203 3:111238545-111238567 CCACTTATAAATAAGAACATGGG - Intronic
960113548 3:113870015-113870037 CCACAGATGAGTGAGAACATGGG - Intronic
960209708 3:114947568-114947590 CCACTTATAAGTGAGAACATAGG - Intronic
960230093 3:115215927-115215949 CCACTTATGAGTGAAAACAAGGG + Intergenic
960736332 3:120785029-120785051 CCACTTATAAGTGAGAACATGGG + Intergenic
960874139 3:122280024-122280046 CCACTTATAAGTGGGAACATGGG + Intronic
960917312 3:122709279-122709301 TCACTTATAAGTGAGAACATAGG + Intronic
961100240 3:124192287-124192309 CCATAAATAAGTGAGAACATGGG - Intronic
961996115 3:131245165-131245187 CCACTTATAAGTGAGAACATTGG + Intronic
962004939 3:131339299-131339321 TCAATTATAAGTGAGAGCTCAGG - Intronic
962034929 3:131641922-131641944 CCACATATGAATGAGAACATAGG - Intronic
962429962 3:135309900-135309922 CCACTTATGAGTGAGAAATGTGG + Intergenic
962633435 3:137303125-137303147 CCACCTATAAGTGAGATAAAGGG + Intergenic
962810263 3:138953357-138953379 CCACTTATAAATGAAAACACAGG + Exonic
963008531 3:140748787-140748809 TCACTTATCTGAGAGAACACTGG + Intergenic
963028037 3:140939592-140939614 CCACTTATGAGTGAGAACATGGG - Intergenic
963098270 3:141569859-141569881 CCACTTACAAGTGAGAACATAGG + Intronic
963655615 3:148045916-148045938 CCACCTATGAGTGAGAACAAGGG + Intergenic
963682533 3:148397363-148397385 CATCTTATAAATGAGAAAACTGG - Intergenic
963824013 3:149931914-149931936 CCACATACGAGTGAGAACATGGG + Intronic
964462720 3:156953580-156953602 CCACTTACAAGTGAGAACACTGG + Intronic
964817572 3:160732903-160732925 CCACTTATAAGTGAGAACATAGG - Intergenic
964964792 3:162478865-162478887 CCACTTATGAGTGTGAACATGGG - Intergenic
965047996 3:163604044-163604066 CCACAAATAAGTGAGAACATGGG - Intergenic
965075618 3:163971259-163971281 CCACAAATAAGTAAGAACATGGG + Intergenic
965236446 3:166130149-166130171 TCACAAATAAGTGAGAACATAGG + Intergenic
965378190 3:167953505-167953527 TCATTTATGAGTGAGAACATAGG + Intergenic
965961759 3:174437633-174437655 CAACTTATAAGTGAGAACATAGG + Intergenic
966018264 3:175171820-175171842 CCACATATGAGTAAGAACATGGG - Intronic
966134258 3:176680740-176680762 CCACTTATGAGTGAGAATGTGGG - Intergenic
966263514 3:178009107-178009129 CTACTTATAATTAAGAACATAGG - Intergenic
966267381 3:178062850-178062872 CCACTTATGAGTGAGAACATAGG + Intergenic
966283553 3:178265213-178265235 TCACTTATGATTGAGAACATGGG + Intergenic
966517777 3:180838103-180838125 CCACTTGTAAGTGAGAACATAGG - Intronic
966726442 3:183113333-183113355 CCACCTATCAGTGAGAACAGCGG - Intronic
966779218 3:183569197-183569219 CCACAAATAAGTGAGAACATGGG + Intergenic
967116253 3:186341932-186341954 CCACCTATGAGTGAGAATATGGG - Intronic
967396045 3:189010020-189010042 CCACTTATAAGTGAGAACATAGG + Intronic
967416133 3:189220662-189220684 CCACTTATAAGTCAGAACATGGG + Intronic
967568801 3:191003086-191003108 CCACTTACGATTGAGAACATGGG + Intergenic
967580347 3:191145823-191145845 TCACTTATAAGTAAGAACACGGG + Intergenic
967690166 3:192464362-192464384 CCACTTCTAAGTGAGAACATAGG + Intronic
968094420 3:195918144-195918166 TCACTTAGCAGTGAGGACACAGG + Intergenic
968311823 3:197690028-197690050 CCACATATGAGTGAGAACACGGG + Intronic
970113734 4:12669451-12669473 CCACTTATAAGTGGGAATATGGG - Intergenic
970303738 4:14708528-14708550 CGACTTGAAAGTTAGAACACTGG + Intergenic
970539528 4:17063590-17063612 CTACATATGAGTGAGAACATAGG - Intergenic
970770964 4:19611935-19611957 CCACCTATGAGTGAGAACATGGG - Intergenic
970804890 4:20019162-20019184 CCACTTATGAGTGAGAACATGGG - Intergenic
971043452 4:22779297-22779319 CCACTTCTAAGTGAGAACAAGGG + Intergenic
971432367 4:26581450-26581472 CCACTTATGAGTGAGAACATGGG + Intronic
971451736 4:26807213-26807235 CAACTTAGAAGTGAGGAGACCGG + Intergenic
971471766 4:27034163-27034185 CTACTTAAAAGTGAGAACATAGG + Intergenic
971651619 4:29283010-29283032 CCACTTATGAGTGAAAACACAGG - Intergenic
971733985 4:30422220-30422242 CCACTTATAAGTGAGAACAGTGG - Intergenic
971861369 4:32109728-32109750 CCACTTACAAATGAAAACATGGG + Intergenic
972001686 4:34044336-34044358 CTACTTATAGGTGAGAATAGTGG - Intergenic
972013885 4:34219831-34219853 CCACATATCAGTGAGAACATAGG - Intergenic
973089307 4:46112706-46112728 ACACTTACAAATGAGAACATGGG - Intronic
973139424 4:46747600-46747622 CCACTTATAAGTGGGAGCTAAGG - Intronic
973225135 4:47775443-47775465 CCACCTATGAGTGAGAACATGGG + Intronic
973290638 4:48466898-48466920 CCAGTTATAGCTGAGGACACAGG + Intergenic
973879064 4:55250435-55250457 CTACTTATAAATGAGAACAGGGG - Intergenic
973916972 4:55643711-55643733 GCACGAATAAGTGAGAATACAGG + Intergenic
973920817 4:55682896-55682918 CCACTTATGAGTGAGAACATGGG + Intergenic
974043550 4:56878299-56878321 CCATGTATGAGTGAGAACATAGG + Intergenic
974159836 4:58124443-58124465 CCACTTACGAGTGAGAACATGGG - Intergenic
974349791 4:60730233-60730255 CCACCTATAAGTGAGAACATGGG + Intergenic
974557265 4:63466885-63466907 CCACCTATGAGTGAGAACATGGG + Intergenic
974570161 4:63635544-63635566 CCACTTATAAATGAGAACATGGG - Intergenic
974639671 4:64611914-64611936 CCACTTATAAGTGAAAACATAGG - Intergenic
974683186 4:65191417-65191439 TCACGTATAAGTGAGAACATGGG + Intergenic
974703074 4:65476496-65476518 CCACTTATAAGTGAGAACATGGG - Intronic
974784601 4:66602140-66602162 CTACATATGAGTGAGAACCCAGG - Intergenic
975308778 4:72878999-72879021 CCACCTATGAGTGAGAACATGGG + Intergenic
975398823 4:73910171-73910193 CCACCTATGAGTGAGAACATAGG - Intergenic
975472165 4:74782330-74782352 CCGCTTATAAGTGAGAACAATGG + Intronic
975722232 4:77259497-77259519 CCACCTATGAATGAGAACATCGG - Intronic
975989914 4:80248168-80248190 CCACTCATAAGTGAGAACATGGG - Intergenic
976079948 4:81345061-81345083 CCACCTATGAGTGAGAACATGGG - Intergenic
976191135 4:82488163-82488185 CCACTTATGAGTGAGAACACAGG + Intronic
976330519 4:83825909-83825931 CCACTTATGAATGAGAACATGGG + Intergenic
976517255 4:85982995-85983017 CCACTTGTGAATGAGAACATGGG + Intronic
976533795 4:86187976-86187998 CCACATGTGAGTGAGAACATGGG + Intronic
976949250 4:90809451-90809473 CCACTTATAAATAAGAACATGGG - Intronic
977052901 4:92152194-92152216 CCACTTACAAGTGAGAACATAGG + Intergenic
977122481 4:93120511-93120533 CCACTTATGAGTGAGAACATGGG - Intronic
977342592 4:95777792-95777814 CCACTTATGAGTGAGAACATGGG - Intergenic
977401253 4:96535151-96535173 CCACTTATAAGTGAGACATGCGG - Intergenic
977507339 4:97918731-97918753 CTACTTATAAGTGAGAACATAGG - Intronic
977637799 4:99320272-99320294 CCACTTTTAAGTGAGAACATTGG + Intronic
977948684 4:102944144-102944166 CCACTTATAAGTAAGAATATGGG - Intronic
977956722 4:103036288-103036310 CCACTTGTAAGTGATAACTGTGG - Intronic
978098317 4:104806441-104806463 CCACCTATGAGTGAGAACATGGG - Intergenic
978237963 4:106482869-106482891 CCACTTATAAGTGAGAACATAGG + Intergenic
978483734 4:109226143-109226165 CCACTTATAAGTGAAAAATGTGG - Intronic
978756054 4:112303974-112303996 CCACCTATGAGTGAGAACATGGG + Intronic
978774630 4:112493319-112493341 CCACTTACAAGTGAGAACATGGG - Intergenic
978948049 4:114522796-114522818 CCACTTATGAGTGAGAACATGGG + Intergenic
978948969 4:114534114-114534136 CCACATACAAGTGAGACCATGGG - Intergenic
979301131 4:119088547-119088569 CTACTTATAAGTGAGAACACGGG + Intergenic
979312696 4:119222528-119222550 CCACATATGAGTGAGTACATGGG + Intronic
979483155 4:121241097-121241119 CCACTTATGAGTGAGAACATAGG + Intergenic
979499744 4:121426336-121426358 CTACTTATAAGTAAGAATATGGG + Intergenic
979657325 4:123210415-123210437 CCACATATAAGTGAGATCATGGG + Intronic
979706761 4:123729249-123729271 CCACTTATAAGTGAGAACATGGG + Intergenic
980258541 4:130415659-130415681 CCAATTATAAGTGAAAAAAGTGG - Intergenic
980390176 4:132134642-132134664 CCACCTATGAGTGAGAACATGGG - Intergenic
980617582 4:135251334-135251356 CCACCTATGAGTGAGAATATGGG - Intergenic
980649074 4:135686794-135686816 CCACTTATAAGTGAGAACATGGG - Intergenic
981053009 4:140330214-140330236 CCACATATGAGTGAGAACATAGG - Intronic
981152823 4:141398708-141398730 CCACCTATGAGTGAGAACATGGG + Intergenic
981302120 4:143199211-143199233 CCGCTTATAAGTGAAAACATGGG + Intronic
981439182 4:144763178-144763200 CCACTTATAAGTGAGAACATGGG - Intergenic
981793633 4:148569350-148569372 CCACTTATAAGTGAGAATATGGG - Intergenic
981919765 4:150074899-150074921 CTACTTATGAGTGAGAACATGGG + Intergenic
982163973 4:152597966-152597988 CCACTTATAAGCAAAAACATGGG - Intergenic
982282212 4:153694904-153694926 CCACAAATAAGCGAGAACATGGG + Intergenic
982705310 4:158702546-158702568 CCATATATGAGTGAGAACATAGG + Intronic
982758857 4:159256265-159256287 TCACTTTTAAGAGGGAACACAGG - Intronic
982765040 4:159336399-159336421 CCACTTATAAGTGAGAACATAGG + Intronic
982982428 4:162156658-162156680 CCACTTATAACTGAGAACATGGG - Intronic
982999660 4:162398288-162398310 CCACATATCAGTGAGAACATAGG - Intergenic
983024493 4:162716254-162716276 CTACTTGTAAGTGAGAACATAGG - Intergenic
983685544 4:170404121-170404143 CCACATATCAGTAAGAACATAGG - Intergenic
983729330 4:170973845-170973867 TCACTTATGAGTGAGAATATAGG + Intergenic
983989394 4:174099249-174099271 CCACTTATTCATGAGAACATGGG - Intergenic
984214323 4:176889791-176889813 CCAGTTGTTAGTGAGAAAACTGG + Intergenic
984305257 4:177981078-177981100 CCACTTATAAGTGAGAAATGTGG + Intronic
984428106 4:179614001-179614023 CCACTTATGAGTGAGAACATGGG - Intergenic
984455717 4:179965566-179965588 CCACTTACGAGTGAGAACAGAGG + Intergenic
985196775 4:187438841-187438863 CCACTTGTAAGTGAGAACATGGG - Intergenic
985325914 4:188770030-188770052 CCACTTATGAGTGAGAACATAGG + Intergenic
986325631 5:6671595-6671617 CCACATATCAATGAGAACATAGG - Intergenic
986768826 5:10953126-10953148 CCACTTATGAGTGAGAACATAGG - Intergenic
986856257 5:11872108-11872130 CCACTTATGAGTGAGAACATGGG + Intronic
986864420 5:11968762-11968784 CCACTTATAAGTGAGAACATGGG + Intergenic
986936384 5:12893060-12893082 CCACGTGTAAGTGAGAACATGGG + Intergenic
986962041 5:13225824-13225846 CCATAAATAAGTGAGAACATGGG - Intergenic
986973756 5:13370928-13370950 CCACTTATAAGTGAGAACTTGGG - Intergenic
987072284 5:14349952-14349974 CCACTTGTAAGTGAGAACATGGG + Intronic
987223567 5:15816405-15816427 CCACTTGTAAGTGAGAACTTAGG - Intronic
987410238 5:17607578-17607600 CCACGTGTGAGTGAGAACATAGG + Intergenic
987419507 5:17702216-17702238 CCACTTATAAGTGAGAACATAGG - Intergenic
987822098 5:22978866-22978888 CCACATATGAGTGAGAACATAGG - Intergenic
988064002 5:26211214-26211236 CCACTGTTAAGTGAGAAAATGGG - Intergenic
988624524 5:32858803-32858825 CCACTTATAAGTGAGTAATTTGG + Intergenic
988850305 5:35174057-35174079 CCACCTATGAGTGAGAACACTGG + Intronic
989072726 5:37528395-37528417 CCACCTATGAGTAAGAACATGGG - Intronic
989121167 5:38005848-38005870 CCACATATCAGTGAGAACATAGG + Intergenic
989154699 5:38333027-38333049 CCACTTATAAGTGAGAACATAGG + Intronic
989283385 5:39670487-39670509 CCATTTATAAGTGGGAACGTAGG + Intergenic
989310654 5:40013248-40013270 CCACCTATGAGTGAGAACATGGG - Intergenic
989693813 5:44175926-44175948 CCACTTATAGATGAGAACATGGG - Intergenic
989861158 5:46377156-46377178 CCACCTATGAGTGAGAATATGGG - Intergenic
990107408 5:52281319-52281341 CCACCTACGAGTGAGAACATGGG - Intergenic
990179721 5:53146965-53146987 CCACCTATGAGTGAGAACATGGG - Intergenic
990190829 5:53258668-53258690 CCACTTATAAGTAAGAACAGTGG - Intergenic
990861484 5:60332414-60332436 CCACTAATAAGTGAAAAGATGGG + Intronic
991009566 5:61868735-61868757 CCACTTATAAGTGAGAACATGGG + Intergenic
991276321 5:64851314-64851336 CCACATATAAGTGAGAACACAGG - Intronic
991661967 5:68959556-68959578 CCACCTATGAGTGAGAACAAGGG - Intergenic
992230138 5:74655820-74655842 CCATTTATAGGTAAGAATACTGG + Intronic
993084791 5:83349989-83350011 TCACTTATAAGTGAGAACACAGG + Intronic
993109024 5:83632445-83632467 CCACATATGAGTGAGAACATAGG + Intergenic
993296370 5:86146469-86146491 CCACCTATGAGTGAGAACATAGG + Intergenic
993591697 5:89802481-89802503 CCACCTATGAGTGAGAACACTGG + Intergenic
993592090 5:89806799-89806821 CCACCTATGAGTGAGAACATGGG - Intergenic
993791218 5:92213873-92213895 CCACTTATAAGTGAGCACAAGGG + Intergenic
993795126 5:92257562-92257584 CCACTTTTAAGTGAGAACATAGG - Intergenic
993820614 5:92611087-92611109 TCACTTATAAGTGAGAACATGGG - Intergenic
993963369 5:94329845-94329867 CCACATATAAGTGAGAACATAGG - Intronic
994100653 5:95888512-95888534 CAACTTTTAAGTGTGGACACTGG + Exonic
994331083 5:98507491-98507513 CCACTTATAAGTGAGAAATGTGG - Intergenic
994565293 5:101438318-101438340 ACATATATAAGTGAGATCACAGG + Intergenic
994823685 5:104684962-104684984 TCATTTATGAGTGAGAACATAGG - Intergenic
994889112 5:105606315-105606337 CCACTTATGAGTGAGAACATGGG - Intergenic
995134476 5:108666047-108666069 CCACATGTCAGTGAGAACATAGG + Intergenic
995144765 5:108774127-108774149 CCACTTATGAGTGAGAACGTGGG + Intronic
995230110 5:109751225-109751247 CCAAATATGAGTGAGAACATAGG + Intronic
995598639 5:113773421-113773443 CCACCTATGAGTGAGAACAAGGG + Intergenic
996112455 5:119581850-119581872 ACACCTATTAGTGAGATCACAGG - Intronic
996204100 5:120709711-120709733 TCACATATGAGTGAGAACATAGG + Intergenic
996317594 5:122177969-122177991 CCACTTATGAGTGAGAACATGGG + Intronic
996793381 5:127317666-127317688 CCACCTATGAGTGAGAACACGGG - Intronic
996968767 5:129337895-129337917 CCACAAATAAGTGAGAAAATGGG - Intergenic
996990538 5:129625062-129625084 CGACCTATGAGTGAGAACATGGG + Intronic
997045129 5:130307047-130307069 CTACTTATAAGTGAGAACATGGG - Intergenic
997094544 5:130896161-130896183 CCACCTATGAGTGAGAACATGGG - Intergenic
997695532 5:135857967-135857989 CCTCTGAGCAGTGAGAACACAGG + Intronic
997875950 5:137547073-137547095 CCACCTATAAGATGGAACACAGG + Intronic
997876060 5:137548089-137548111 CCACTTATAAGTGAAAACATAGG + Intronic
998536812 5:142940525-142940547 CCACTTATAAGTGAGAATATGGG + Intronic
998674401 5:144390751-144390773 CCACTTATGAGTGAGAACATGGG + Intronic
999071268 5:148746132-148746154 CCACTTGTATGTGAGAACAAGGG + Intergenic
999700782 5:154225899-154225921 CCACCTATGAGTGAAAACAATGG - Intronic
999940707 5:156539484-156539506 CCACTTATAAGTGAGGACATAGG + Intronic
999956134 5:156703971-156703993 ACACTTATCAGTGAGAACTCTGG + Intronic
1000049846 5:157552953-157552975 CTACAAATAAGTGAGAACATGGG - Intronic
1000213627 5:159133594-159133616 CCAATTATAAGGGAGAACATGGG + Intergenic
1000387207 5:160686041-160686063 CCATTTGCAAGAGAGAACACAGG + Intronic
1000485466 5:161837387-161837409 GCACATAAAAATGAGAACACAGG - Intergenic
1000592135 5:163170958-163170980 CCACCTATGAGTGAGAACATGGG - Intergenic
1001244854 5:170098464-170098486 CAATTTATAGGTGAGGACACAGG + Intergenic
1002336387 5:178481789-178481811 CCACCTATGACTGAGAACATAGG - Intronic
1002626909 5:180535388-180535410 CCACTTGTAAGTGAGAACATCGG + Intronic
1002734275 5:181371829-181371851 TCATTTATGAGTGAGAACATCGG + Intergenic
1002750263 6:102296-102318 CCATTTATGAGTGAGAACATCGG - Intergenic
1003080849 6:3020012-3020034 CCACTTATAAGTTAGAACATGGG + Intergenic
1003296961 6:4838377-4838399 CCAGTTATGAGTGAGAACTTAGG + Intronic
1003441527 6:6147070-6147092 CAGCTTATGAGTGAGAACATAGG - Intronic
1003755815 6:9118665-9118687 CCACTTATATCTGAGAGCACAGG + Intergenic
1004246455 6:13982122-13982144 CCATAGATGAGTGAGAACACCGG + Intergenic
1004539748 6:16538657-16538679 CCACCTATGAGTGAGAACATGGG + Intronic
1004563701 6:16775771-16775793 CCACCTATGAGTGAGAACATGGG - Intergenic
1004630286 6:17414479-17414501 CTACCTATGAGTGAGAACATGGG + Intronic
1006625347 6:35393569-35393591 CCACTTCTCAGTAAGAACATGGG - Intronic
1007197080 6:40071615-40071637 CCACTTGTGAGTGGGAACATAGG + Intergenic
1007277250 6:40683812-40683834 CCACCTATGAGTGAGAACATTGG - Intergenic
1007502437 6:42308700-42308722 CCACTTATAAGTAAGAACATGGG - Intronic
1007837656 6:44686589-44686611 CTACTTATAAGTGAGAACATAGG + Intergenic
1008203089 6:48616772-48616794 ATACTTATAAGTGAGAATATGGG + Intergenic
1008299718 6:49820719-49820741 CCACTTATAAGTGAGGACATGGG - Intergenic
1008345758 6:50424459-50424481 CCACTTATAAGTGAGAACATGGG - Intergenic
1008531198 6:52461296-52461318 CCACTTATAATTGAGAAACGTGG + Intronic
1008915237 6:56779950-56779972 CCATCTATGAGTGAGAACATGGG + Intronic
1009333601 6:62457227-62457249 CCACTTATGAGTGAGAACATAGG + Intergenic
1009445568 6:63738503-63738525 CCACCTATGAGTGAGAATATGGG - Intronic
1009454838 6:63844080-63844102 CCACTTGTAAATGAGAACATGGG + Intronic
1009996645 6:70902804-70902826 CCATTTATCAGTGAGACCATTGG - Intronic
1010181324 6:73089635-73089657 CCACCTATGAGTGAGAACATAGG + Intronic
1010303169 6:74285082-74285104 CCACTTATGAGTAAGAACATGGG + Intergenic
1010412436 6:75575819-75575841 TCACTTATAAGTGAGAACACGGG - Intergenic
1010501383 6:76605072-76605094 CCACTTATAAGTGAGGAAATTGG - Intergenic
1010680626 6:78794887-78794909 CCACCTATGAGTGAGAACATGGG - Intergenic
1010681007 6:78799218-78799240 CCATCTATGAGTGAGAACATGGG - Intergenic
1010896927 6:81376416-81376438 CCACTTATGAGTGAGAACATAGG - Intergenic
1010988191 6:82450175-82450197 CCACTTTAAAATGAGAAAACAGG + Intergenic
1011308250 6:85953128-85953150 CCACCTATGAGTGAGAACAAGGG + Intergenic
1011380414 6:86736996-86737018 CCACCTATGAGTGAGAACATGGG - Intergenic
1011589589 6:88959124-88959146 CCACTTACAAGTGAGAACACAGG - Intronic
1011598924 6:89042055-89042077 CTACCTATGAGTGAGAACATGGG - Intergenic
1011796864 6:90965062-90965084 CCACAAATAAATGAGAACATGGG + Intergenic
1011862478 6:91777048-91777070 TCACTTATCAGTGAGAGCATAGG - Intergenic
1012020270 6:93909216-93909238 CCACTTATGAATGAGAACATGGG - Intergenic
1012029567 6:94041131-94041153 TAGCTTATAAGTGAGAACATAGG + Intergenic
1012117571 6:95322484-95322506 CTACCTATGAGTGAGAACATGGG + Intergenic
1012130262 6:95482048-95482070 CCACTTATAAGTGAGAATAAAGG - Intergenic
1012357052 6:98327557-98327579 CCACTTATGAGTGAGGACATAGG + Intergenic
1012563930 6:100622004-100622026 CCACTTATAAGTGAGAACATGGG - Intronic
1012821605 6:104091338-104091360 CCACCTATGAGTGAGAACATGGG - Intergenic
1012870293 6:104665107-104665129 CCACTTATAAGTGAGAACATAGG - Intergenic
1013060823 6:106632037-106632059 CCACAAATAGGTGAGAACATGGG + Intronic
1013376370 6:109519037-109519059 CTACTTATAAATGAGAATACAGG + Intronic
1013479290 6:110539358-110539380 CCACTTATAAGTGAGGACACGGG + Intergenic
1013573919 6:111460182-111460204 CCACTTGTAAGTGAGAACATGGG - Intronic
1013709966 6:112885858-112885880 CCACTTATGAGTGAGAACATGGG - Intergenic
1013814407 6:114080696-114080718 CCACTTATAAGTGAGACATGCGG - Intronic
1013893686 6:115058096-115058118 CCACTCATAAGTGAGAACGCAGG + Intergenic
1013893705 6:115058318-115058340 CCACTCATAAGTGAGAACGCAGG + Intergenic
1013985078 6:116182095-116182117 CCACTTATGAGTGAGAACATTGG + Intronic
1014170487 6:118274055-118274077 CCACTGAACAGTGAGAACCCAGG + Intronic
1014335392 6:120127294-120127316 CCACTTATAAGTGAGAATATGGG + Intergenic
1014379400 6:120721099-120721121 CCACTTATAAGTGAGAACATGGG + Intergenic
1014510873 6:122320481-122320503 CCACTTATAAGTGAGGAGAAGGG + Intergenic
1014666969 6:124250157-124250179 CCATTTATAAATCAGAACATGGG + Intronic
1014872081 6:126609226-126609248 CCACTTATGAGTGAGAACATAGG + Intergenic
1014894292 6:126882992-126883014 CCACTTTTAAGTGAGAACATGGG + Intergenic
1014978539 6:127919339-127919361 CCACATATAAATGAGATCATGGG - Intergenic
1015292486 6:131553318-131553340 CCACTTATGAGTGAGAACAGGGG + Intergenic
1016066557 6:139689015-139689037 CCATCTATGAGTGAGAACACGGG - Intergenic
1016103782 6:140136571-140136593 CCACGTATTAGTGATAACATGGG - Intergenic
1016332935 6:142972893-142972915 CCACTTATAAGTGAGAACATAGG - Intergenic
1016471678 6:144381248-144381270 CCACTTAAAAGTGAGAAATGTGG + Intronic
1016547473 6:145240452-145240474 CCACTTATGAGTGAGAACATGGG + Intergenic
1017103812 6:150869402-150869424 CCACTTATGAGTGAGAACATGGG + Intronic
1017474912 6:154780597-154780619 CCACTTACGAGTGAGAACATGGG + Intronic
1018045366 6:159961248-159961270 CCTCGTGTAAGTGAGAAGACAGG - Intergenic
1018305999 6:162456165-162456187 AAACTTATTAGTTAGAACACGGG + Intronic
1018324322 6:162648680-162648702 ACATTTAAAAGAGAGAACACTGG - Intronic
1019074125 6:169373380-169373402 ACACTTAACAGTGAGAACATAGG - Intergenic
1019238527 6:170644144-170644166 CCATTTATGAGTGAGAACATCGG + Intergenic
1019663310 7:2238099-2238121 CCATTTATTGGTGAGAAAACAGG - Intronic
1019753475 7:2749427-2749449 CCACCTATGAGTGAGAACATGGG - Intronic
1019844582 7:3484736-3484758 CCACATAGGAGTGAGAACATGGG + Intronic
1019855441 7:3601902-3601924 CCACCTATGAATGAGAACATGGG + Intronic
1020331042 7:7017303-7017325 CCACTTATAAATGAGAACGTGGG - Intergenic
1020497516 7:8875044-8875066 CCACTTATAAGTGAGAAATGTGG - Intergenic
1020525021 7:9248302-9248324 CCACATATAAGAGAAAATACAGG + Intergenic
1020671602 7:11122086-11122108 TCACTTATGAGTGAGAACATGGG + Intronic
1020796439 7:12683378-12683400 CTACTTAGAAGTCAGAACACAGG + Intergenic
1020847602 7:13306854-13306876 GAACTTATGAGTGAGAACAGGGG + Intergenic
1021194167 7:17656286-17656308 CCACAAATAAGTGAAAACAGAGG - Intergenic
1021226483 7:18033825-18033847 CCACTTATAAGTGACAACATAGG + Intergenic
1021770096 7:23991193-23991215 CCACTTATAAGTGAGAACATAGG - Intergenic
1022059071 7:26772456-26772478 CCACTTACAAGTGAGAACATAGG + Intronic
1022313588 7:29221686-29221708 CTATTTAAAAGTGAGAACATGGG + Intronic
1022669811 7:32445490-32445512 CCACTTATAAGTGAGAACATGGG - Intergenic
1022994373 7:35739429-35739451 CCACATATGAGTGAGAACATGGG + Intergenic
1023167411 7:37356537-37356559 CCACTTATGAGTGAGAACATGGG - Intronic
1023452734 7:40304661-40304683 CCACATATGAGTGAGAACATTGG + Intronic
1023709768 7:42979610-42979632 CCATATATCAGTGAGAACATGGG - Intergenic
1024435454 7:49348352-49348374 CCATTTATAAGTGAGAACTTGGG + Intergenic
1024696452 7:51861260-51861282 CCACCTATGAGTGAGAACAGGGG - Intergenic
1024898513 7:54289666-54289688 CCACATATGAATGAGAACATGGG - Intergenic
1025001848 7:55322447-55322469 CCACTTATAAGTAAGAACATGGG - Intergenic
1025113910 7:56241535-56241557 CCACTTATAAGTGAGAAATGCGG + Intergenic
1026235778 7:68526077-68526099 CCACATATCAGTGAGAACATAGG - Intergenic
1026392669 7:69917735-69917757 CCACTTATAAGTGAGAACATAGG + Intronic
1026669959 7:72381616-72381638 CCGCTTATGAGTGAGAACACGGG - Intronic
1027367261 7:77471166-77471188 TCACATATGAGTGAGAACATAGG - Intergenic
1027715273 7:81661665-81661687 CCACTTACAAGTGACAACATGGG - Intergenic
1028143956 7:87301046-87301068 CCACTTATAAATGAGAACATGGG - Intergenic
1028255012 7:88584680-88584702 CCACCTATGAGTGAGAACATGGG + Intergenic
1028319513 7:89441574-89441596 CCACCTATGAGTGAGAACATGGG + Intergenic
1028346361 7:89788818-89788840 CCACTTATGAATGAGAACACTGG + Intergenic
1028815334 7:95137309-95137331 CCACCTATGAGTAAGAACATGGG + Intronic
1028860707 7:95646920-95646942 CCATTTATAAGTGAGAACATGGG + Intergenic
1029009334 7:97242208-97242230 CCACTTATGAGTGAGAACATGGG - Intergenic
1029057271 7:97760042-97760064 CCACTTATGAATGAGAACATAGG + Intergenic
1029131670 7:98336060-98336082 CCACTTATAAGTGAGATATGCGG - Intronic
1029145934 7:98446056-98446078 CCACTTATAAGTCAGAAATGCGG - Intergenic
1031209021 7:118798244-118798266 ACACTATTAAATGAGAACACAGG + Intergenic
1031247988 7:119341465-119341487 CCACCTATGAGTGAGAACATGGG - Intergenic
1031318983 7:120297285-120297307 CCACATATAAGTGAGAACATTGG + Intronic
1031387426 7:121168811-121168833 CCACAAATAAGTGAAAACATGGG + Intronic
1031592092 7:123605760-123605782 CTACTTGTAAGTGAGAACATGGG - Intronic
1031620996 7:123933295-123933317 CCACTTATAAGCGAGAACATGGG + Intronic
1031656616 7:124363988-124364010 CCACTTATAAATGAGAACGTAGG + Intergenic
1031874758 7:127126393-127126415 CCACTTATAAGTGGGAGCGTCGG - Intronic
1032014684 7:128371002-128371024 CCACAAATAAGTGAGACCATGGG - Intergenic
1032562346 7:132905364-132905386 CCACTTATAAGTGAGAACATGGG - Intronic
1032861400 7:135883349-135883371 CCACATATGAGTGAGAACATGGG - Intergenic
1033204935 7:139411041-139411063 CCACTTATATATTAGAATACTGG - Intronic
1033268029 7:139903170-139903192 CCACATATCAGTGAGAACATAGG + Intronic
1033396614 7:140979934-140979956 TCACTTATAAGTGAGAGCATTGG - Intergenic
1033489498 7:141828123-141828145 CCACTTGTAAGTCACAACATGGG + Intergenic
1033943017 7:146679234-146679256 CCACTTACAAGTGAGAACAGAGG + Intronic
1033984832 7:147212501-147212523 TCACTTATAATTGTGAACATAGG - Intronic
1034368701 7:150574703-150574725 CCACCTATGAGTGAGAATATGGG + Intergenic
1035480721 7:159180757-159180779 CCACTTATAAAGGAGAACATGGG - Intergenic
1035509242 8:162463-162485 CCATTTATGAGTGAGAACATCGG - Intergenic
1035558272 8:584008-584030 CCACCTATGAGTGAGAACATGGG + Intergenic
1035949539 8:4005053-4005075 CCACACATCAGTGAGAACATAGG - Intronic
1036032087 8:4985126-4985148 CCACTTATAAGTGAGAACAGTGG - Intronic
1036421291 8:8598358-8598380 CCACTTATAAGTGAGAACATAGG + Intergenic
1036936666 8:13009166-13009188 CCATGTATAAGTGAGATCACTGG - Intronic
1037163922 8:15803774-15803796 CTGCTTATGAGTGAGAACATGGG + Intergenic
1037253813 8:16928753-16928775 CCATTCATAAGTGACAACATCGG - Intergenic
1037385084 8:18330925-18330947 CCACTTTTAAATGAGAACATGGG - Intergenic
1037476560 8:19263432-19263454 CCACTTATCAGTGAGAACATAGG + Intergenic
1038377587 8:27058071-27058093 CCACCTATAAGTGAGAACATGGG + Intergenic
1038387331 8:27161075-27161097 CCACTCATAAGGAACAACACAGG - Intergenic
1038525523 8:28269920-28269942 TTACTTATAAGTGAGAACATGGG - Intergenic
1038619804 8:29131085-29131107 CCACTTATAAGCGAGAACATGGG - Intronic
1038711246 8:29948474-29948496 CCACTACTAACTGATAACACAGG - Intergenic
1039074744 8:33679919-33679941 CCACATATCAGTGAGAACATAGG - Intergenic
1039104367 8:33974330-33974352 CCACTGATAAGTAAGAACATGGG - Intergenic
1039160550 8:34613994-34614016 CCACATATCAGTGAGAACATAGG - Intergenic
1039168809 8:34717127-34717149 CCACTTATAAGTAAGAAAGTGGG + Intergenic
1039191420 8:34980529-34980551 CCACTTATGAGTGAAAACATGGG + Intergenic
1039314957 8:36361008-36361030 CCACTTACAAGTGAGAAATGCGG - Intergenic
1039331786 8:36545324-36545346 CCACATATAAGTGAGGACATGGG - Intergenic
1039375766 8:37031617-37031639 CTACTTATAAGTGAGAACATAGG + Intergenic
1040357085 8:46629164-46629186 CCACTTATAAGTGAGAACATGGG - Intergenic
1040935659 8:52779135-52779157 AGACTTATAAGTGAGAACATGGG + Intergenic
1040947631 8:52900723-52900745 CCACTTATAAGTGAGGACAGTGG + Intergenic
1040993251 8:53374904-53374926 CCACCTATGAGTGAGAACATGGG - Intergenic
1041010984 8:53542994-53543016 CCATTTATAAGTGAGAACATGGG + Intergenic
1041018496 8:53615282-53615304 CCACCTATGAGTGAGAATATGGG - Intergenic
1041129703 8:54684905-54684927 CCACTTATAAGTGAGAACATGGG - Intergenic
1041248945 8:55916354-55916376 CCATTTTTAAGTTAGAAAACAGG - Intronic
1041404970 8:57488256-57488278 CCACTTATAAGTGAGAACATGGG - Intergenic
1041891675 8:62876729-62876751 ACATTTATGAGTGAGAACATGGG - Intronic
1043020136 8:74990015-74990037 CCACATGTAAGTGAGAACATAGG - Intronic
1043233063 8:77826660-77826682 CCACATATGAGTGAGAACATAGG + Intergenic
1043699785 8:83271140-83271162 CCACCTATGAGTGAGAACATGGG - Intergenic
1043889366 8:85639585-85639607 CCACCTATGAGGGAGAACATGGG - Intergenic
1044026723 8:87182122-87182144 CCATTTATAAATGAGAACTGTGG + Intronic
1044128384 8:88487971-88487993 CCACTTATAAGTGAGAACACCGG - Intergenic
1044207147 8:89503652-89503674 TCACTTATAAGTGAGAACATGGG + Intergenic
1044237109 8:89843626-89843648 CCACTTATAAGTGAGAACATGGG + Intergenic
1044255443 8:90054695-90054717 CCATACATAAGTGAGATCACAGG + Intergenic
1044272343 8:90261234-90261256 CCACTTATAAGTGAGAACATGGG - Intergenic
1044342180 8:91058611-91058633 ACATTTGTAAGTGAGAACATGGG + Intergenic
1044718053 8:95119249-95119271 CCACCTATGAGTGAGAACATGGG + Intergenic
1045775451 8:105797212-105797234 CCACTTATAGGTGAGGAGACTGG - Intronic
1045871116 8:106927944-106927966 CCACTTATGAATGAGAACATGGG + Intergenic
1045936201 8:107682064-107682086 CCACTTATAAGTGAGAACATGGG + Intergenic
1045957304 8:107923856-107923878 CCACTTATAATTGAGAACATGGG - Intronic
1045963132 8:107992320-107992342 CCACTTATAAGTGAAAACACGGG - Intronic
1045969612 8:108064937-108064959 CCAACTATGAGTGAGAACATGGG - Intronic
1046156425 8:110295883-110295905 CCACTTATAAGTGAGAACATGGG - Intergenic
1046218368 8:111179913-111179935 CCACCTATGAGTGAGAACATGGG + Intergenic
1046421326 8:113987075-113987097 CCACTTATAAGTGAGAACATGGG - Intergenic
1046476517 8:114751854-114751876 CCACTTATGAGTTAGAACATTGG - Intergenic
1046646254 8:116788949-116788971 CCACATATAAGTGAGGTCAGAGG - Intronic
1046847981 8:118940096-118940118 CCACCTATGAGTGAGAACATGGG - Intronic
1047066055 8:121284402-121284424 TCACTTATAAGTGAGAACATGGG - Intergenic
1047085220 8:121508242-121508264 CCACCTATGAGTGAGAATATGGG + Intergenic
1047091285 8:121578394-121578416 CCACTTAGAAGTAAGAACATGGG + Intergenic
1047165150 8:122430438-122430460 TCACTTATAAGTGAAAACATGGG + Intergenic
1047359635 8:124156245-124156267 CCACTTATAAGTGAGAAAATGGG + Intergenic
1047611354 8:126523856-126523878 CCACTTATGAGTGAGAACATAGG - Intergenic
1048022800 8:130555880-130555902 GAACTTCTAAGAGAGAACACTGG - Intergenic
1048241434 8:132745932-132745954 CCACTTATAGGTAAGAACATAGG - Intronic
1048555914 8:135475814-135475836 CATTTTACAAGTGAGAACACAGG + Intronic
1048600637 8:135915779-135915801 TTGCTTATAAGTGAGAACATGGG + Intergenic
1048780413 8:137992893-137992915 TCACTTATAAGTGAGAGCATGGG + Intergenic
1048858987 8:138709553-138709575 CCACCTATGAGTGAGAACATGGG - Intronic
1049143406 8:140979026-140979048 CCACATATGAGTGAGAACATGGG - Intronic
1049307941 8:141917277-141917299 CCACTTACAAGTGAGAACATGGG - Intergenic
1050400752 9:5251179-5251201 CCACATATAAGTGAGAACTATGG - Intergenic
1050441560 9:5669358-5669380 CCAATTATGAGTGAGAACGTAGG + Intronic
1050492929 9:6208450-6208472 CCACTTATGAGTGAGAACATGGG - Intergenic
1050522383 9:6514593-6514615 CCACAAATAAGTGACAACAAGGG + Intergenic
1050668747 9:7971981-7972003 TCACTGAGATGTGAGAACACAGG - Intergenic
1050809118 9:9720899-9720921 CCACTTTGAAGTGAGAACATGGG - Intronic
1050950493 9:11585045-11585067 CCATTTATGAGTGAGAACACAGG + Intergenic
1050980263 9:12002490-12002512 CCACCTATCAGTGAGAACATTGG - Intergenic
1051321546 9:15910771-15910793 CCACTTATGAGTGAGAAAGTGGG + Intronic
1052198180 9:25743816-25743838 CCATCTATGAGTGAGAACATGGG + Intergenic
1052530105 9:29672107-29672129 CCATGTATAAGTGAGAACATGGG + Intergenic
1052598000 9:30586448-30586470 CCACTTATAAGTGAAAACATGGG - Intergenic
1052639272 9:31143810-31143832 CCATTTGTGAGTGAGAACAGGGG - Intergenic
1052694876 9:31864966-31864988 CCACCTATGAGTGAGAACATGGG + Intergenic
1053608329 9:39682325-39682347 CCACCTATGAGTAAGAACATGGG + Intergenic
1053798672 9:41749192-41749214 CCACTTATAAGTGAGACCATGGG - Intergenic
1053866169 9:42438685-42438707 CCACCTATGAGTAAGAACATGGG + Intergenic
1054146530 9:61565769-61565791 CCATTTATAAGTGAGACCATGGG + Intergenic
1054187087 9:61961237-61961259 CCACTTATAAGTGAGACCATGGG - Intergenic
1054245201 9:62660084-62660106 CCACCTATGAGTAAGAACATGGG - Intergenic
1054466266 9:65496837-65496859 CCACTTATAAGTGAGACCATAGG + Intergenic
1054559329 9:66694615-66694637 CCACCTATGAGTAAGAACATGGG - Intergenic
1054651421 9:67627285-67627307 CCACTTATAAGTGAGACCATGGG + Intergenic
1056217740 9:84420770-84420792 CCATCTATGAGTGAGAACATGGG + Intergenic
1056385860 9:86096546-86096568 CCACTAATAAATGCAAACACAGG + Intronic
1057344747 9:94239412-94239434 CCAATTATGAGTGAGAACATAGG + Intergenic
1058217865 9:102257353-102257375 CCACTTATGAGTGAGAACATAGG + Intergenic
1058249627 9:102675276-102675298 CTACTTATAAGTGAGAACATGGG - Intergenic
1058289685 9:103223718-103223740 CCACTTATAAGTGAGAACATAGG - Intergenic
1058317966 9:103592667-103592689 CCACCTATGAGTGAGAACATGGG + Intergenic
1058449750 9:105084928-105084950 CCACCTATGAGTGAGAACATGGG + Intergenic
1059022700 9:110593756-110593778 CCACTTACAAGTGAGAACATGGG + Intergenic
1059095218 9:111406283-111406305 TCACATACAAGTGAGAACATAGG - Intronic
1059193643 9:112350137-112350159 CCACTTATGAGTAAGAACATAGG - Intergenic
1059957797 9:119536297-119536319 CCACTTATGAGTGAGAACATGGG - Intergenic
1060321229 9:122562743-122562765 CCACAAATAAGTGAGAATATGGG + Intergenic
1060708876 9:125836120-125836142 CCACTTATCAGTGAGAACATGGG - Intronic
1061268609 9:129523258-129523280 CCACTTATGGGTGAGAAAACTGG + Intergenic
1061981683 9:134108398-134108420 CCACATAGGAGGGAGAACACGGG - Intergenic
1062659418 9:137620995-137621017 CCGTTTATAAATGAGAAGACAGG + Intronic
1062758729 9:138324436-138324458 CCATTTATGAGTGAGAACATCGG + Intergenic
1203532590 Un_GL000213v1:160837-160859 CTGCATATAAGTGAGAACATGGG - Intergenic
1185692356 X:2166247-2166269 CCATTTATGAGGGAGAACATAGG - Intergenic
1185692381 X:2166861-2166883 CCACTTATGAGGGAGAACAAAGG - Intergenic
1185724604 X:2409500-2409522 CCACTTATGAAGGAGAACATGGG + Intronic
1185748155 X:2588341-2588363 CCACTTACGAGTGAAAACATGGG - Intergenic
1185799625 X:2998200-2998222 CCACTTATAAGTGAGAACATGGG + Intergenic
1185828185 X:3272938-3272960 CCACTTATAAGTGAGAACATGGG + Intronic
1185851715 X:3495155-3495177 CCACATATAAGTGAGATCATAGG + Intergenic
1185911884 X:3988963-3988985 CCACTTATGAGTGAGAACATGGG + Intergenic
1185915161 X:4026974-4026996 CCATTTATAAGTGAGAAACGTGG - Intergenic
1185925967 X:4146793-4146815 CCACTTATAAGTGAGAACATAGG + Intergenic
1185955309 X:4482757-4482779 CCACTTGTGAGTGAAAACATAGG - Intergenic
1186013300 X:5162436-5162458 CCACATATAAGTGACAAAATTGG + Intergenic
1186046898 X:5546135-5546157 CCACTTATAAGTAAGAATAGTGG + Intergenic
1186075712 X:5876236-5876258 TCACTTATGAGTGAGAACATAGG - Intronic
1187371446 X:18711230-18711252 CCACTTTTAAGTGAGAACATGGG - Intronic
1187431620 X:19229975-19229997 CCACTTATGCGTGAGAACATGGG + Intergenic
1187464753 X:19516832-19516854 CCACTTATGAGTAAGAACATGGG + Intergenic
1187704867 X:21999668-21999690 CCACCTATGAGTGAGAACATGGG + Intergenic
1187749244 X:22443897-22443919 CCACATATCAGTGAGAACATAGG - Intergenic
1187762950 X:22608048-22608070 TCATTTATAAGTGAGAACATGGG - Intergenic
1187784942 X:22873328-22873350 CCACTTATGAGTGAGAACATGGG - Intergenic
1187834701 X:23420075-23420097 CCACTTATAAGTGAGAACATGGG - Intergenic
1188536041 X:31197996-31198018 CCACACATGAGTGAGAACATGGG - Intronic
1188555617 X:31409010-31409032 CCACCTATGAGTGAGAACATGGG + Intronic
1188576268 X:31654674-31654696 CCACTTATAAATGAGAACATGGG - Intronic
1188610160 X:32085519-32085541 TCACTTATAAGTGAGAACATGGG + Intronic
1188633721 X:32401478-32401500 CCACAAATAACTGAGAACATGGG - Intronic
1188724367 X:33563638-33563660 CCACAAATAAGTGACAACATAGG - Intergenic
1188790357 X:34402089-34402111 CCACTTATAAGTGAAAACGTGGG - Intergenic
1188886419 X:35556116-35556138 CCACTTATAAGTGAGAACATGGG - Intergenic
1188916232 X:35914229-35914251 TTACTTATAAGTGAGAACATAGG + Intergenic
1189643333 X:43098717-43098739 CCGCTTATGAGTGAGAACATGGG - Intergenic
1189737993 X:44090824-44090846 CTACTTATAAGAGAAGACACTGG - Intergenic
1189870688 X:45380140-45380162 CCACATATGAGTGAGAACATTGG + Intergenic
1190459254 X:50655001-50655023 CCACTTATAAGTAAGAACAATGG - Intronic
1190535904 X:51427674-51427696 CCACCTATGAGTGAGAATATAGG + Intergenic
1190821221 X:53974824-53974846 CCACTTACAAGTGAGAACATGGG - Intronic
1190887482 X:54542321-54542343 CCACCTATGAGTGAGAACATGGG + Intronic
1190906289 X:54731688-54731710 CCACCTATGAGTGAGAACATGGG + Intergenic
1191074984 X:56443368-56443390 CCACCTATGAGTGAGAACATAGG - Intergenic
1191196163 X:57725701-57725723 CCACCTATGAGTGAGAACATAGG + Intergenic
1191216948 X:57942363-57942385 CCAATTATAAGTGAAAACATAGG + Intergenic
1191233226 X:58114006-58114028 GCACCTATGAGTGAGAACATGGG - Intergenic
1191677157 X:63803666-63803688 CCACTTATGAAAGAGAACACAGG - Intergenic
1191749522 X:64526925-64526947 CCACTTATAAGTGAGAAATGTGG - Intergenic
1191829390 X:65399942-65399964 CCACAAATAAGTGAGAAAATGGG - Intronic
1191836250 X:65466229-65466251 CTACATATAAGTGAGATCATGGG + Intronic
1191968205 X:66784564-66784586 CCATTTATGAGTGAGAACATGGG - Intergenic
1191995757 X:67093660-67093682 CCACTCATAAGTGAGAACATAGG + Intergenic
1192082156 X:68058787-68058809 CCACTTACAGTTGAGAAAACTGG + Intronic
1192336538 X:70225428-70225450 CCACTTATAAGTGAGAACAAAGG - Intergenic
1192415063 X:70972462-70972484 CCACTTATAAGTAAGAAATGTGG - Intergenic
1192702257 X:73487308-73487330 CCACTTATGAGTGAGAACATGGG - Intergenic
1192852818 X:74975675-74975697 TCACTTATAAGTGGGAACTAAGG - Intergenic
1192952201 X:76029037-76029059 CCACTTATGAGTGAGAACATTGG - Intergenic
1192982346 X:76359254-76359276 CCACCTATGAGTGAGAACATGGG + Intergenic
1193007015 X:76631247-76631269 CCACTTATGAGTAAGCACATAGG + Intergenic
1193015819 X:76733033-76733055 CCACTTATGAGTGAGAACATAGG - Intergenic
1193032583 X:76915403-76915425 CCATTTATAAGTGAGACCATGGG - Intergenic
1193096225 X:77552378-77552400 CCACCTATGAGTGAGAACATGGG - Intronic
1193152883 X:78142824-78142846 CCACTTATGAGTGAGAACATGGG + Intergenic
1193153825 X:78152247-78152269 GCACTTATAAGTGAGAACATAGG + Intergenic
1193159289 X:78209855-78209877 CCACTTGTAAGTGAGAACACAGG - Intergenic
1193189897 X:78558066-78558088 CCAATTATAAGTGAGAACATGGG + Intergenic
1193199444 X:78671058-78671080 CTACTTATAAGTGAGAACATGGG - Intergenic
1193283200 X:79680627-79680649 CCACATATAAGTGAGAACACAGG - Intergenic
1193308719 X:79979823-79979845 CCACTTGTAAGTGAGAACATGGG + Intergenic
1193460782 X:81788852-81788874 CCACTTATGAGTGAGAACACTGG + Intergenic
1193572131 X:83157075-83157097 CTACTTATGAGTGAGAACATGGG - Intergenic
1193633168 X:83914989-83915011 CCACTTATGAGTGAGAACATTGG + Intergenic
1193649730 X:84115863-84115885 CCACTTATAAGTGAGAACATGGG - Intronic
1193689582 X:84624159-84624181 CCACTTATAAGTGAGAACATAGG + Intergenic
1193701227 X:84763776-84763798 CAACTTGTAAGTGAGAACTTAGG + Intergenic
1193725232 X:85030671-85030693 CCACTTATAAGTGAGAACAGAGG - Intronic
1193860304 X:86657518-86657540 CCACTCATAAGGGAGAAAACAGG - Intronic
1194181852 X:90720245-90720267 CCACTTATAGGTAAGAATATAGG - Intergenic
1194184198 X:90752504-90752526 CCATTTATAAGTGAGGACATGGG - Intergenic
1194194409 X:90873910-90873932 CCACTAATAAGTGAGAACATGGG - Intergenic
1194213716 X:91101152-91101174 CCACTTATAAGTGACAACATTGG + Intergenic
1194245478 X:91506458-91506480 CAACTTGTAAGTGAGAACATGGG - Intergenic
1194245797 X:91510433-91510455 CCATCTATGAGTGAGAACATGGG + Intergenic
1194298814 X:92160385-92160407 CCGCTTATGAGTGAGAACATAGG + Intronic
1194304097 X:92220965-92220987 CCACCTATGAGTGAGAACATGGG - Intronic
1194362010 X:92963868-92963890 CCACTTATAAGTGAGAACATAGG + Intergenic
1194390736 X:93314782-93314804 TCACTTATGAGTGAGAAAATGGG + Intergenic
1194499925 X:94669637-94669659 CCACAAACAAGTGAGAACATTGG + Intergenic
1194678030 X:96816988-96817010 CCACAAATAAGTGAGAACATGGG - Intronic
1194789637 X:98130964-98130986 CCACTTACAAGTGAGGACATGGG + Intergenic
1194842703 X:98763626-98763648 CCACTTATGAGTGAGAACATGGG + Intergenic
1194902282 X:99527473-99527495 TCACTTACAAGTGAGAACATAGG - Intergenic
1194913049 X:99671017-99671039 CCACTTATAAGCGAGAACATGGG - Intergenic
1194913287 X:99673578-99673600 CCAATCATAAGTGAGAACAGTGG - Intergenic
1194922773 X:99787610-99787632 CAACTTAAAGGTGGGAACACAGG + Intergenic
1195116431 X:101703587-101703609 CGACAAATAAGTGAGAACATGGG - Intergenic
1195121111 X:101753506-101753528 CCACTTATAAGTGAGAACATGGG - Intergenic
1195136800 X:101916156-101916178 CCACTTATGAGTGAGAAATGCGG - Intronic
1195436226 X:104846421-104846443 CCACCTATGAGTGAGAACATGGG + Intronic
1195495727 X:105530811-105530833 CCACAAATAAGTGAGAACATGGG + Intronic
1195499984 X:105585590-105585612 CCACTTATAAGTGAGAAATGTGG + Intronic
1195851614 X:109288398-109288420 CCACAAATAAGTGAGAATATGGG + Intergenic
1195901363 X:109801070-109801092 TCACTTATAACTGAGAACTGAGG - Intergenic
1196001203 X:110788227-110788249 TCTCTTATAAGAGAGAAGACAGG - Intronic
1196080683 X:111627549-111627571 CCACTTATAAGTGAGAACATGGG - Intergenic
1196115910 X:111999343-111999365 CCACGTATGAGTGAGAACATGGG + Intronic
1196142856 X:112284323-112284345 CAACCCATAAGTGAGAAAACTGG - Intergenic
1196335305 X:114525377-114525399 CCGCTTAAAAGTGAGAACAAGGG - Intergenic
1196347972 X:114689051-114689073 TCACTTATAAGTGAGAGCTAAGG - Intronic
1196372038 X:114990108-114990130 TCACTTATAAGTGAGAAAAATGG - Intergenic
1196986138 X:121274047-121274069 CCACCTATGAGTGAGAACTGCGG + Intergenic
1197054674 X:122102561-122102583 CCACTTATGAGTGAGAACACAGG - Intergenic
1197087067 X:122491186-122491208 CCATTTATAAGTAAGAACATAGG + Intergenic
1197270978 X:124424548-124424570 CCATATATGAGTGAGAACATGGG + Intronic
1197576439 X:128218002-128218024 TCACTTATAAGTGAGGTCATGGG - Intergenic
1197615808 X:128690279-128690301 CCACCTATGAGTGAGAACATGGG + Intergenic
1197808597 X:130420814-130420836 CCACTTACAAGTGAGAACTTAGG + Intergenic
1198225790 X:134644668-134644690 CCACTTATAAGCAAGAACAATGG + Intronic
1198232731 X:134707556-134707578 CCACCTATGAGTGAGAACATGGG + Intronic
1198501545 X:137254252-137254274 CCACTTATAAGTGAGACATGTGG - Intergenic
1198519627 X:137439748-137439770 CCACTTATTAGTGAGAACATGGG - Intergenic
1198796515 X:140402430-140402452 CCACTTATAAGTCAGAACATGGG - Intergenic
1198925242 X:141784013-141784035 CCACAAATAAGTGAGAACATGGG + Intergenic
1198976852 X:142345468-142345490 CCACTTATGAGTGAAAACATGGG - Intergenic
1199007809 X:142722917-142722939 CTACTTATGAGTGAGAACATGGG - Intergenic
1199021576 X:142884635-142884657 CCACTTATGAGTGAGAACATGGG - Intergenic
1199027159 X:142953478-142953500 CCACTTATAAGTGAGAATGTGGG + Intergenic
1199032830 X:143021195-143021217 CCCCAAATAAGTGAGAACATGGG - Intergenic
1199113074 X:143957814-143957836 CCACTTATAAGTGAGAGCATGGG + Intergenic
1199165068 X:144662606-144662628 CTACTTATAAGTAAGAAGATGGG + Intergenic
1199317525 X:146398396-146398418 CTACTTATAAGTGAGAATGTGGG + Intergenic
1199556650 X:149116373-149116395 CCACTTATAAGTGAGACATATGG - Intergenic
1199890442 X:152073677-152073699 CCACCTATGAGTGAGAATATGGG + Intergenic
1200340010 X:155386287-155386309 CCACTTACAGGTGAGAACACAGG + Intergenic
1200346460 X:155454401-155454423 CCACTTACAGGTGAGAACACAGG - Intergenic
1200528478 Y:4302162-4302184 CCACTTATAGGTAAGAATATAGG - Intergenic
1200530789 Y:4334427-4334449 CCATTTATAAGTGAGGACATGGG - Intergenic
1200541025 Y:4456302-4456324 CCACTAATAAGTGAGAACATGGG - Intergenic
1200564448 Y:4747710-4747732 CAACTTGTAAGTGAGAACATGGG - Intergenic
1200564764 Y:4751682-4751704 TCACCTATGAGTGAGAACATGGG + Intergenic
1200616431 Y:5385371-5385393 CCGCTTATGAGTGAGAACATAGG + Intronic
1200670258 Y:6080083-6080105 CCACTTATAAGTGAGAACATGGG + Intergenic
1200811116 Y:7486206-7486228 CCACAAATAAGTGAGATCATAGG - Intergenic
1200958430 Y:8973477-8973499 GCACTCACAAGTGAGAACAGTGG - Intergenic
1201184036 Y:11380581-11380603 CCACTTATAGGTGAGAATATGGG - Intergenic
1201250689 Y:12054521-12054543 CCACTTATAAGTGAGAATATGGG - Intergenic
1201392029 Y:13509157-13509179 CTACCTATAAGAGAGAACATAGG - Intergenic
1201418973 Y:13777059-13777081 CCACCTATGAGTGAGAACACTGG + Intergenic
1201543871 Y:15139096-15139118 TCACTGATGAGTGAGAACATGGG - Intergenic
1201566848 Y:15374318-15374340 CCACTTATGAGTGAGAACATGGG - Intergenic
1201888266 Y:18911415-18911437 CCACTTATAAGTGAGAACATGGG - Intergenic
1201890385 Y:18937405-18937427 CCACTTACAAGTGAGAACATGGG + Intergenic
1201970475 Y:19787981-19788003 CCACTTATGAGTGAGAACATAGG - Intergenic
1202056323 Y:20835282-20835304 CCACTTATAAGTGAGAACACAGG - Intergenic
1202190522 Y:22238747-22238769 ACACTTATGAGTGAGAACATTGG + Intergenic