ID: 1202056335

View in Genome Browser
Species Human (GRCh38)
Location Y:20835335-20835357
Sequence AAGGTTATAATGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202056323_1202056335 30 Left 1202056323 Y:20835282-20835304 CCTGTGTTCTCACTTATAAGTGG 0: 7
1: 124
2: 273
3: 409
4: 480
Right 1202056335 Y:20835335-20835357 AAGGTTATAATGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202056335 Original CRISPR AAGGTTATAATGAACTCTGG GGG Intergenic
No off target data available for this crispr