ID: 1202057257 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:20848110-20848132 |
Sequence | GACCCACTGTGTATCCAGAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202057257_1202057259 | -4 | Left | 1202057257 | Y:20848110-20848132 | CCAGTCTGGATACACAGTGGGTC | No data | ||
Right | 1202057259 | Y:20848129-20848151 | GGTCATGGACCCACTTGATGAGG | No data | ||||
1202057257_1202057262 | 21 | Left | 1202057257 | Y:20848110-20848132 | CCAGTCTGGATACACAGTGGGTC | No data | ||
Right | 1202057262 | Y:20848154-20848176 | GTCTGTCCCTTATTAGAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202057257 | Original CRISPR | GACCCACTGTGTATCCAGAC TGG (reversed) | Intergenic | ||