ID: 1202057257

View in Genome Browser
Species Human (GRCh38)
Location Y:20848110-20848132
Sequence GACCCACTGTGTATCCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202057257_1202057259 -4 Left 1202057257 Y:20848110-20848132 CCAGTCTGGATACACAGTGGGTC No data
Right 1202057259 Y:20848129-20848151 GGTCATGGACCCACTTGATGAGG No data
1202057257_1202057262 21 Left 1202057257 Y:20848110-20848132 CCAGTCTGGATACACAGTGGGTC No data
Right 1202057262 Y:20848154-20848176 GTCTGTCCCTTATTAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202057257 Original CRISPR GACCCACTGTGTATCCAGAC TGG (reversed) Intergenic
No off target data available for this crispr