ID: 1202057259

View in Genome Browser
Species Human (GRCh38)
Location Y:20848129-20848151
Sequence GGTCATGGACCCACTTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202057253_1202057259 14 Left 1202057253 Y:20848092-20848114 CCTACTGGAAGGCGTCGTCCAGT No data
Right 1202057259 Y:20848129-20848151 GGTCATGGACCCACTTGATGAGG No data
1202057257_1202057259 -4 Left 1202057257 Y:20848110-20848132 CCAGTCTGGATACACAGTGGGTC No data
Right 1202057259 Y:20848129-20848151 GGTCATGGACCCACTTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202057259 Original CRISPR GGTCATGGACCCACTTGATG AGG Intergenic
No off target data available for this crispr