ID: 1202057262

View in Genome Browser
Species Human (GRCh38)
Location Y:20848154-20848176
Sequence GTCTGTCCCTTATTAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202057261_1202057262 -8 Left 1202057261 Y:20848139-20848161 CCACTTGATGAGGCAGTCTGTCC 0: 12
1: 1922
2: 4522
3: 2222
4: 907
Right 1202057262 Y:20848154-20848176 GTCTGTCCCTTATTAGAGCTTGG No data
1202057257_1202057262 21 Left 1202057257 Y:20848110-20848132 CCAGTCTGGATACACAGTGGGTC No data
Right 1202057262 Y:20848154-20848176 GTCTGTCCCTTATTAGAGCTTGG No data
1202057260_1202057262 -7 Left 1202057260 Y:20848138-20848160 CCCACTTGATGAGGCAGTCTGTC 0: 15
1: 2431
2: 4893
3: 1620
4: 703
Right 1202057262 Y:20848154-20848176 GTCTGTCCCTTATTAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202057262 Original CRISPR GTCTGTCCCTTATTAGAGCT TGG Intergenic
No off target data available for this crispr