ID: 1202058364

View in Genome Browser
Species Human (GRCh38)
Location Y:20859679-20859701
Sequence GGACAGTGATGTCAGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202058364_1202058367 -1 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058367 Y:20859701-20859723 CTGTTTTGTCCTTTGTATTAGGG No data
1202058364_1202058372 27 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058372 Y:20859729-20859751 CTGTTATAAGTGTGGAAAGGAGG No data
1202058364_1202058366 -2 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058366 Y:20859700-20859722 CCTGTTTTGTCCTTTGTATTAGG No data
1202058364_1202058369 19 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058369 Y:20859721-20859743 GGGCCATGCTGTTATAAGTGTGG No data
1202058364_1202058371 24 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058371 Y:20859726-20859748 ATGCTGTTATAAGTGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202058364 Original CRISPR GGACAGTGATGTCAGCAAAA TGG (reversed) Intergenic
No off target data available for this crispr