ID: 1202058365

View in Genome Browser
Species Human (GRCh38)
Location Y:20859700-20859722
Sequence CCTAATACAAAGGACAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202058365_1202058369 -2 Left 1202058365 Y:20859700-20859722 CCTGTTTTGTCCTTTGTATTAGG No data
Right 1202058369 Y:20859721-20859743 GGGCCATGCTGTTATAAGTGTGG No data
1202058365_1202058371 3 Left 1202058365 Y:20859700-20859722 CCTGTTTTGTCCTTTGTATTAGG No data
Right 1202058371 Y:20859726-20859748 ATGCTGTTATAAGTGTGGAAAGG No data
1202058365_1202058372 6 Left 1202058365 Y:20859700-20859722 CCTGTTTTGTCCTTTGTATTAGG No data
Right 1202058372 Y:20859729-20859751 CTGTTATAAGTGTGGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202058365 Original CRISPR CCTAATACAAAGGACAAAAC AGG (reversed) Intergenic
No off target data available for this crispr