ID: 1202058369

View in Genome Browser
Species Human (GRCh38)
Location Y:20859721-20859743
Sequence GGGCCATGCTGTTATAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202058364_1202058369 19 Left 1202058364 Y:20859679-20859701 CCATTTTGCTGACATCACTGTCC No data
Right 1202058369 Y:20859721-20859743 GGGCCATGCTGTTATAAGTGTGG No data
1202058365_1202058369 -2 Left 1202058365 Y:20859700-20859722 CCTGTTTTGTCCTTTGTATTAGG No data
Right 1202058369 Y:20859721-20859743 GGGCCATGCTGTTATAAGTGTGG No data
1202058363_1202058369 28 Left 1202058363 Y:20859670-20859692 CCTACTTTGCCATTTTGCTGACA No data
Right 1202058369 Y:20859721-20859743 GGGCCATGCTGTTATAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202058369 Original CRISPR GGGCCATGCTGTTATAAGTG TGG Intergenic
No off target data available for this crispr