ID: 1202070460

View in Genome Browser
Species Human (GRCh38)
Location Y:20986630-20986652
Sequence GCAACCACTCAGAGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202070456_1202070460 21 Left 1202070456 Y:20986586-20986608 CCATGGTCAATTTGGTGGCTTCC No data
Right 1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG No data
1202070455_1202070460 22 Left 1202070455 Y:20986585-20986607 CCCATGGTCAATTTGGTGGCTTC No data
Right 1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG No data
1202070457_1202070460 0 Left 1202070457 Y:20986607-20986629 CCAGCACTATCAGAGCCATCATT No data
Right 1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202070460 Original CRISPR GCAACCACTCAGAGGCAAGC TGG Intergenic
No off target data available for this crispr