ID: 1202071098

View in Genome Browser
Species Human (GRCh38)
Location Y:20992282-20992304
Sequence TCTCCTGGTTGGTCTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202071098_1202071102 26 Left 1202071098 Y:20992282-20992304 CCTCTAGGAGACCAACCAGGAGA No data
Right 1202071102 Y:20992331-20992353 TTGACACAGTCCCCAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202071098 Original CRISPR TCTCCTGGTTGGTCTCCTAG AGG (reversed) Intergenic
No off target data available for this crispr