ID: 1202074374

View in Genome Browser
Species Human (GRCh38)
Location Y:21023524-21023546
Sequence CTCCTCACTGCTGAGAAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202074374_1202074378 -1 Left 1202074374 Y:21023524-21023546 CCTCGTTTCTCAGCAGTGAGGAG No data
Right 1202074378 Y:21023546-21023568 GGTCTAGGCCTCAGTGGTTTTGG 0: 20
1: 50
2: 85
3: 104
4: 208
1202074374_1202074381 30 Left 1202074374 Y:21023524-21023546 CCTCGTTTCTCAGCAGTGAGGAG No data
Right 1202074381 Y:21023577-21023599 TGTTGCCGAAGAGTCTATTTGGG No data
1202074374_1202074377 -7 Left 1202074374 Y:21023524-21023546 CCTCGTTTCTCAGCAGTGAGGAG No data
Right 1202074377 Y:21023540-21023562 TGAGGAGGTCTAGGCCTCAGTGG 0: 35
1: 63
2: 52
3: 61
4: 335
1202074374_1202074380 29 Left 1202074374 Y:21023524-21023546 CCTCGTTTCTCAGCAGTGAGGAG No data
Right 1202074380 Y:21023576-21023598 CTGTTGCCGAAGAGTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202074374 Original CRISPR CTCCTCACTGCTGAGAAACG AGG (reversed) Intergenic
No off target data available for this crispr