ID: 1202080331

View in Genome Browser
Species Human (GRCh38)
Location Y:21077649-21077671
Sequence TATCACAGGATGCAGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202080328_1202080331 -2 Left 1202080328 Y:21077628-21077650 CCCACAGATGAGTTTGTGTCATA No data
Right 1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG No data
1202080327_1202080331 1 Left 1202080327 Y:21077625-21077647 CCACCCACAGATGAGTTTGTGTC No data
Right 1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG No data
1202080329_1202080331 -3 Left 1202080329 Y:21077629-21077651 CCACAGATGAGTTTGTGTCATAT No data
Right 1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202080331 Original CRISPR TATCACAGGATGCAGCATCC AGG Intergenic
No off target data available for this crispr