ID: 1202080685

View in Genome Browser
Species Human (GRCh38)
Location Y:21081056-21081078
Sequence CACAATTCCCACTGTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202080685_1202080690 23 Left 1202080685 Y:21081056-21081078 CCCTTTCCACAGTGGGAATTGTG No data
Right 1202080690 Y:21081102-21081124 GATAAAGACATACCTGAGACAGG 0: 1651
1: 4048
2: 7021
3: 9867
4: 10371
1202080685_1202080691 24 Left 1202080685 Y:21081056-21081078 CCCTTTCCACAGTGGGAATTGTG No data
Right 1202080691 Y:21081103-21081125 ATAAAGACATACCTGAGACAGGG 0: 52
1: 2982
2: 6336
3: 10592
4: 11380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202080685 Original CRISPR CACAATTCCCACTGTGGAAA GGG (reversed) Intergenic
No off target data available for this crispr