ID: 1202085511

View in Genome Browser
Species Human (GRCh38)
Location Y:21132791-21132813
Sequence CAGGAAACATTCAGTCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202085508_1202085511 2 Left 1202085508 Y:21132766-21132788 CCAACATCTTCTCCTGGTGAGGC No data
Right 1202085511 Y:21132791-21132813 CAGGAAACATTCAGTCATGATGG No data
1202085510_1202085511 -10 Left 1202085510 Y:21132778-21132800 CCTGGTGAGGCTTCAGGAAACAT No data
Right 1202085511 Y:21132791-21132813 CAGGAAACATTCAGTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202085511 Original CRISPR CAGGAAACATTCAGTCATGA TGG Intergenic
No off target data available for this crispr