ID: 1202090650

View in Genome Browser
Species Human (GRCh38)
Location Y:21185156-21185178
Sequence TCCTAGGGTCTTTCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202090650_1202090656 24 Left 1202090650 Y:21185156-21185178 CCAGCCTCAGAAAGACCCTAGGA No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202090650 Original CRISPR TCCTAGGGTCTTTCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr