ID: 1202090652

View in Genome Browser
Species Human (GRCh38)
Location Y:21185171-21185193
Sequence GTTTGAGGCTACAGGTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202090652_1202090656 9 Left 1202090652 Y:21185171-21185193 CCCTAGGACCTGTAGCCTCAAAC No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090652_1202090657 23 Left 1202090652 Y:21185171-21185193 CCCTAGGACCTGTAGCCTCAAAC No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202090652 Original CRISPR GTTTGAGGCTACAGGTCCTA GGG (reversed) Intergenic