ID: 1202090655 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:21185186-21185208 |
Sequence | TTAGCAAGCTGCATTGTTTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202090655_1202090656 | -6 | Left | 1202090655 | Y:21185186-21185208 | CCTCAAACAATGCAGCTTGCTAA | No data | ||
Right | 1202090656 | Y:21185203-21185225 | TGCTAAGACAATGCATGCCCTGG | No data | ||||
1202090655_1202090657 | 8 | Left | 1202090655 | Y:21185186-21185208 | CCTCAAACAATGCAGCTTGCTAA | No data | ||
Right | 1202090657 | Y:21185217-21185239 | ATGCCCTGGACAGAATGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202090655 | Original CRISPR | TTAGCAAGCTGCATTGTTTG AGG (reversed) | Intergenic | ||