ID: 1202090655

View in Genome Browser
Species Human (GRCh38)
Location Y:21185186-21185208
Sequence TTAGCAAGCTGCATTGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202090655_1202090657 8 Left 1202090655 Y:21185186-21185208 CCTCAAACAATGCAGCTTGCTAA No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data
1202090655_1202090656 -6 Left 1202090655 Y:21185186-21185208 CCTCAAACAATGCAGCTTGCTAA No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202090655 Original CRISPR TTAGCAAGCTGCATTGTTTG AGG (reversed) Intergenic
No off target data available for this crispr