ID: 1202090656

View in Genome Browser
Species Human (GRCh38)
Location Y:21185203-21185225
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202090654_1202090656 1 Left 1202090654 Y:21185179-21185201 CCTGTAGCCTCAAACAATGCAGC No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090651_1202090656 20 Left 1202090651 Y:21185160-21185182 CCTCAGAAAGACCCTAGGACCTG No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090652_1202090656 9 Left 1202090652 Y:21185171-21185193 CCCTAGGACCTGTAGCCTCAAAC No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090653_1202090656 8 Left 1202090653 Y:21185172-21185194 CCTAGGACCTGTAGCCTCAAACA No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090655_1202090656 -6 Left 1202090655 Y:21185186-21185208 CCTCAAACAATGCAGCTTGCTAA No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data
1202090650_1202090656 24 Left 1202090650 Y:21185156-21185178 CCAGCCTCAGAAAGACCCTAGGA No data
Right 1202090656 Y:21185203-21185225 TGCTAAGACAATGCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202090656 Original CRISPR TGCTAAGACAATGCATGCCC TGG Intergenic