ID: 1202090657

View in Genome Browser
Species Human (GRCh38)
Location Y:21185217-21185239
Sequence ATGCCCTGGACAGAATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202090655_1202090657 8 Left 1202090655 Y:21185186-21185208 CCTCAAACAATGCAGCTTGCTAA No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data
1202090652_1202090657 23 Left 1202090652 Y:21185171-21185193 CCCTAGGACCTGTAGCCTCAAAC No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data
1202090653_1202090657 22 Left 1202090653 Y:21185172-21185194 CCTAGGACCTGTAGCCTCAAACA No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data
1202090654_1202090657 15 Left 1202090654 Y:21185179-21185201 CCTGTAGCCTCAAACAATGCAGC No data
Right 1202090657 Y:21185217-21185239 ATGCCCTGGACAGAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202090657 Original CRISPR ATGCCCTGGACAGAATGCTG AGG Intergenic
No off target data available for this crispr