ID: 1202092307

View in Genome Browser
Species Human (GRCh38)
Location Y:21206489-21206511
Sequence ATTTATAAGTTAATCTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202092307_1202092309 17 Left 1202092307 Y:21206489-21206511 CCTACCAAGATTAACTTATAAAT No data
Right 1202092309 Y:21206529-21206551 AGATCAATAATGAGAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202092307 Original CRISPR ATTTATAAGTTAATCTTGGT AGG (reversed) Intergenic
No off target data available for this crispr