ID: 1202092536

View in Genome Browser
Species Human (GRCh38)
Location Y:21208943-21208965
Sequence CCAGTGAAGAAAGATGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202092536_1202092542 -6 Left 1202092536 Y:21208943-21208965 CCTGACACATCTTTCTTCACTGG No data
Right 1202092542 Y:21208960-21208982 CACTGGGTGGGGCTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202092536 Original CRISPR CCAGTGAAGAAAGATGTGTC AGG (reversed) Intergenic
No off target data available for this crispr