ID: 1202096396

View in Genome Browser
Species Human (GRCh38)
Location Y:21252741-21252763
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202096396_1202096398 22 Left 1202096396 Y:21252741-21252763 CCTTATTATATTCTTATTCTGCA No data
Right 1202096398 Y:21252786-21252808 TAATTTGTTATAAATTATTTAGG No data
1202096396_1202096397 -10 Left 1202096396 Y:21252741-21252763 CCTTATTATATTCTTATTCTGCA No data
Right 1202096397 Y:21252754-21252776 TTATTCTGCATTGCATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202096396 Original CRISPR TGCAGAATAAGAATATAATA AGG (reversed) Intergenic
No off target data available for this crispr