ID: 1202096397

View in Genome Browser
Species Human (GRCh38)
Location Y:21252754-21252776
Sequence TTATTCTGCATTGCATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202096396_1202096397 -10 Left 1202096396 Y:21252741-21252763 CCTTATTATATTCTTATTCTGCA No data
Right 1202096397 Y:21252754-21252776 TTATTCTGCATTGCATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202096397 Original CRISPR TTATTCTGCATTGCATTTAT TGG Intergenic
No off target data available for this crispr