ID: 1202096398

View in Genome Browser
Species Human (GRCh38)
Location Y:21252786-21252808
Sequence TAATTTGTTATAAATTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202096396_1202096398 22 Left 1202096396 Y:21252741-21252763 CCTTATTATATTCTTATTCTGCA No data
Right 1202096398 Y:21252786-21252808 TAATTTGTTATAAATTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202096398 Original CRISPR TAATTTGTTATAAATTATTT AGG Intergenic
No off target data available for this crispr