ID: 1202098666

View in Genome Browser
Species Human (GRCh38)
Location Y:21281871-21281893
Sequence CTGGAAAGATGCAGAATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202098660_1202098666 22 Left 1202098660 Y:21281826-21281848 CCAAATGCACTTAGGATGCAACA No data
Right 1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG No data
1202098659_1202098666 23 Left 1202098659 Y:21281825-21281847 CCCAAATGCACTTAGGATGCAAC No data
Right 1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG No data
1202098657_1202098666 28 Left 1202098657 Y:21281820-21281842 CCTTCCCCAAATGCACTTAGGAT No data
Right 1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG No data
1202098658_1202098666 24 Left 1202098658 Y:21281824-21281846 CCCCAAATGCACTTAGGATGCAA No data
Right 1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202098666 Original CRISPR CTGGAAAGATGCAGAATTCC TGG Intergenic
No off target data available for this crispr