ID: 1202099051

View in Genome Browser
Species Human (GRCh38)
Location Y:21286576-21286598
Sequence TAGGATCAATAACATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202099050_1202099051 -6 Left 1202099050 Y:21286559-21286581 CCATGCTCATGGATAGGTAGGAT No data
Right 1202099051 Y:21286576-21286598 TAGGATCAATAACATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202099051 Original CRISPR TAGGATCAATAACATGAAAA TGG Intergenic
No off target data available for this crispr