ID: 1202101310

View in Genome Browser
Species Human (GRCh38)
Location Y:21310483-21310505
Sequence CTTCCTAACAGGCCGCGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202101306_1202101310 -7 Left 1202101306 Y:21310467-21310489 CCTGTTCTGCAGCCGGCTTCCTA No data
Right 1202101310 Y:21310483-21310505 CTTCCTAACAGGCCGCGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202101310 Original CRISPR CTTCCTAACAGGCCGCGGAC AGG Intergenic
No off target data available for this crispr