ID: 1202101593

View in Genome Browser
Species Human (GRCh38)
Location Y:21314289-21314311
Sequence GCCACCGCAGCCGGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202101593_1202101598 13 Left 1202101593 Y:21314289-21314311 CCTTCTGGGCCGGCTGCGGTGGC No data
Right 1202101598 Y:21314325-21314347 CCCAGCACTTTGCGAGGCCGAGG 0: 323
1: 119461
2: 268723
3: 215350
4: 126141
1202101593_1202101600 16 Left 1202101593 Y:21314289-21314311 CCTTCTGGGCCGGCTGCGGTGGC No data
Right 1202101600 Y:21314328-21314350 AGCACTTTGCGAGGCCGAGGCGG 0: 243
1: 91647
2: 188990
3: 138789
4: 71590
1202101593_1202101602 29 Left 1202101593 Y:21314289-21314311 CCTTCTGGGCCGGCTGCGGTGGC No data
Right 1202101602 Y:21314341-21314363 GCCGAGGCGGGCAGATTACGAGG 0: 62
1: 4232
2: 26520
3: 49358
4: 64233
1202101593_1202101601 17 Left 1202101593 Y:21314289-21314311 CCTTCTGGGCCGGCTGCGGTGGC No data
Right 1202101601 Y:21314329-21314351 GCACTTTGCGAGGCCGAGGCGGG 0: 244
1: 87919
2: 226479
3: 238010
4: 155670
1202101593_1202101596 7 Left 1202101593 Y:21314289-21314311 CCTTCTGGGCCGGCTGCGGTGGC No data
Right 1202101596 Y:21314319-21314341 TGTAATCCCAGCACTTTGCGAGG 0: 1144
1: 302864
2: 268344
3: 150612
4: 131701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202101593 Original CRISPR GCCACCGCAGCCGGCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr