ID: 1202105053

View in Genome Browser
Species Human (GRCh38)
Location Y:21355008-21355030
Sequence ACAGGGACATTTAATTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202105053_1202105058 23 Left 1202105053 Y:21355008-21355030 CCTGCAGAATTAAATGTCCCTGT No data
Right 1202105058 Y:21355054-21355076 GGTTCTCTCAGCATGCAGCTGGG No data
1202105053_1202105057 22 Left 1202105053 Y:21355008-21355030 CCTGCAGAATTAAATGTCCCTGT No data
Right 1202105057 Y:21355053-21355075 TGGTTCTCTCAGCATGCAGCTGG No data
1202105053_1202105056 2 Left 1202105053 Y:21355008-21355030 CCTGCAGAATTAAATGTCCCTGT No data
Right 1202105056 Y:21355033-21355055 GACAGATTTGAAGACAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202105053 Original CRISPR ACAGGGACATTTAATTCTGC AGG (reversed) Intergenic
No off target data available for this crispr