ID: 1202111628

View in Genome Browser
Species Human (GRCh38)
Location Y:21427379-21427401
Sequence AAGCATACTCAGACCATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202111621_1202111628 28 Left 1202111621 Y:21427328-21427350 CCTGGAGCTAGGACACATAGTGA No data
Right 1202111628 Y:21427379-21427401 AAGCATACTCAGACCATGCATGG No data
1202111626_1202111628 3 Left 1202111626 Y:21427353-21427375 CCAAGGCTCAGGGAGGAGACTGC 0: 14
1: 1
2: 22
3: 48
4: 437
Right 1202111628 Y:21427379-21427401 AAGCATACTCAGACCATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202111628 Original CRISPR AAGCATACTCAGACCATGCA TGG Intergenic
No off target data available for this crispr