ID: 1202113890

View in Genome Browser
Species Human (GRCh38)
Location Y:21451739-21451761
Sequence GATTATGGGGAGCCCCGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202113883_1202113890 24 Left 1202113883 Y:21451692-21451714 CCTCCACTTTGCACGCTCTGGCG No data
Right 1202113890 Y:21451739-21451761 GATTATGGGGAGCCCCGCGTTGG No data
1202113884_1202113890 21 Left 1202113884 Y:21451695-21451717 CCACTTTGCACGCTCTGGCGTTC No data
Right 1202113890 Y:21451739-21451761 GATTATGGGGAGCCCCGCGTTGG No data
1202113886_1202113890 -1 Left 1202113886 Y:21451717-21451739 CCTTCACTGGATTATTTGTAGAG 0: 3
1: 3
2: 5
3: 11
4: 225
Right 1202113890 Y:21451739-21451761 GATTATGGGGAGCCCCGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202113890 Original CRISPR GATTATGGGGAGCCCCGCGT TGG Intergenic
No off target data available for this crispr