ID: 1202113909

View in Genome Browser
Species Human (GRCh38)
Location Y:21451813-21451835
Sequence TCCGGCAGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202113898_1202113909 25 Left 1202113898 Y:21451765-21451787 CCAGATGTTGGGGAAACCAGCCC No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113903_1202113909 4 Left 1202113903 Y:21451786-21451808 CCCACACCAGCTGGCGGTTACCT No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113904_1202113909 3 Left 1202113904 Y:21451787-21451809 CCACACCAGCTGGCGGTTACCTC No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113901_1202113909 9 Left 1202113901 Y:21451781-21451803 CCAGCCCCACACCAGCTGGCGGT No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113905_1202113909 -2 Left 1202113905 Y:21451792-21451814 CCAGCTGGCGGTTACCTCGAATC No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113902_1202113909 5 Left 1202113902 Y:21451785-21451807 CCCCACACCAGCTGGCGGTTACC No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data
1202113897_1202113909 28 Left 1202113897 Y:21451762-21451784 CCACCAGATGTTGGGGAAACCAG No data
Right 1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202113909 Original CRISPR TCCGGCAGGTACCCCGAGTC CGG Intergenic
No off target data available for this crispr