ID: 1202116650 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:21475446-21475468 |
| Sequence | GCATGAAAACAAATGGACTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202116650_1202116652 | -9 | Left | 1202116650 | Y:21475446-21475468 | CCTTAGTCCATTTGTTTTCATGC | No data | ||
| Right | 1202116652 | Y:21475460-21475482 | TTTTCATGCTATTGAGTTGTTGG | 0: 14 1: 11 2: 43 3: 183 4: 702 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202116650 | Original CRISPR | GCATGAAAACAAATGGACTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||