ID: 1202116650

View in Genome Browser
Species Human (GRCh38)
Location Y:21475446-21475468
Sequence GCATGAAAACAAATGGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202116650_1202116652 -9 Left 1202116650 Y:21475446-21475468 CCTTAGTCCATTTGTTTTCATGC No data
Right 1202116652 Y:21475460-21475482 TTTTCATGCTATTGAGTTGTTGG 0: 14
1: 11
2: 43
3: 183
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202116650 Original CRISPR GCATGAAAACAAATGGACTA AGG (reversed) Intergenic
No off target data available for this crispr