ID: 1202116816

View in Genome Browser
Species Human (GRCh38)
Location Y:21476758-21476780
Sequence AAGCATACTCAGACCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202116816_1202116818 3 Left 1202116816 Y:21476758-21476780 CCATGCATGGTCTGAGTATGCTT No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116816_1202116823 28 Left 1202116816 Y:21476758-21476780 CCATGCATGGTCTGAGTATGCTT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202116816 Original CRISPR AAGCATACTCAGACCATGCA TGG (reversed) Intergenic
No off target data available for this crispr