ID: 1202116818

View in Genome Browser
Species Human (GRCh38)
Location Y:21476784-21476806
Sequence GCAGTCTCCTCCCTGAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 14, 1: 1, 2: 22, 3: 48, 4: 437}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202116813_1202116818 9 Left 1202116813 Y:21476752-21476774 CCCAGCCCATGCATGGTCTGAGT No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116807_1202116818 28 Left 1202116807 Y:21476733-21476755 CCCTGATGGGCCTTTCTCCCCCA No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116814_1202116818 8 Left 1202116814 Y:21476753-21476775 CCAGCCCATGCATGGTCTGAGTA No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116815_1202116818 4 Left 1202116815 Y:21476757-21476779 CCCATGCATGGTCTGAGTATGCT No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116808_1202116818 27 Left 1202116808 Y:21476734-21476756 CCTGATGGGCCTTTCTCCCCCAG No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116809_1202116818 18 Left 1202116809 Y:21476743-21476765 CCTTTCTCCCCCAGCCCATGCAT No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116812_1202116818 10 Left 1202116812 Y:21476751-21476773 CCCCAGCCCATGCATGGTCTGAG No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116811_1202116818 11 Left 1202116811 Y:21476750-21476772 CCCCCAGCCCATGCATGGTCTGA No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437
1202116816_1202116818 3 Left 1202116816 Y:21476758-21476780 CCATGCATGGTCTGAGTATGCTT No data
Right 1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG 0: 14
1: 1
2: 22
3: 48
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202116818 Original CRISPR GCAGTCTCCTCCCTGAGCCT TGG Intergenic
900780066 1:4612201-4612223 GCAGCCTCCTACCTGAACCCAGG - Intergenic
901306974 1:8239837-8239859 ACAGGCTCCTCCCTGGGGCTGGG - Intergenic
901459842 1:9384966-9384988 CCAGTCTCTTGCCAGAGCCTGGG + Intergenic
902665406 1:17934216-17934238 GAAGTGTCATCTCTGAGCCTGGG + Intergenic
903032827 1:20476076-20476098 GCAGTCTCATCTGTGACCCTGGG - Intergenic
903281657 1:22253595-22253617 GCAGCCTCCTTCCAGAGCCCCGG - Intergenic
903541278 1:24097719-24097741 ATAGTCTCCTCCATCAGCCTGGG - Intronic
904012761 1:27399200-27399222 GCTGTCTCCTCCCTTAGGCTGGG + Intergenic
904212403 1:28894701-28894723 GCATGCTCTTCCCTGAGTCTTGG + Intronic
904300422 1:29550206-29550228 GCAGGCTCCTGCCTCTGCCTGGG + Intergenic
904431499 1:30467408-30467430 GCAGGCTGCTCCCTGGGCATGGG + Intergenic
905232198 1:36521495-36521517 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
905232229 1:36521615-36521637 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
905232258 1:36521735-36521757 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
905232307 1:36521935-36521957 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
905232326 1:36522015-36522037 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
905232334 1:36522055-36522077 CCTGTCTCCTCCCTCAGACTGGG + Intergenic
906412549 1:45590442-45590464 CCATTCTCCTGCCTCAGCCTGGG - Intronic
906506094 1:46380767-46380789 GCAGTCTGGTTCCTGAGCTTGGG + Intergenic
906634482 1:47399579-47399601 GAAGGCTCCTTCTTGAGCCTTGG - Intergenic
906669844 1:47646396-47646418 CCATTCACCTCCCTGGGCCTGGG + Intergenic
906677247 1:47701979-47702001 CCAGCCTCCTCCCTGACACTTGG + Intergenic
907320691 1:53600231-53600253 GCAGGCTCTTCTCTGAGCCCGGG + Exonic
907395809 1:54189325-54189347 GCAGTCTCCTCTGGGAGCCTAGG + Intronic
907523152 1:55038238-55038260 GCAGCCCCCTTCCTGGGCCTGGG + Intergenic
907756629 1:57316901-57316923 GTAGTCTCCTCACTGAGTGTGGG + Intronic
908170434 1:61499031-61499053 GCAGTCTGCCCCATGACCCTTGG - Intergenic
909227460 1:73044128-73044150 GCAGTCTCCAGCGTGAGCCAAGG + Intergenic
910864686 1:91777425-91777447 CCAGTCTCCTCCCCTAGTCTTGG + Intronic
911152405 1:94608206-94608228 CCCGTCTCCTCCTTGGGCCTTGG + Intergenic
912201482 1:107462877-107462899 CAAGTGACCTCCCTGAGCCTTGG - Intronic
912435241 1:109656899-109656921 GCTGTCCCTTCCCTGAGCCCCGG + Intronic
912436951 1:109668612-109668634 GCTGTCCCTTCCCTGAGCCCTGG + Intronic
912439642 1:109688357-109688379 GCTGTCTCTTCCCTGAGCCCCGG + Intronic
912467044 1:109881463-109881485 AAAGTCTCCTCCCTGTGACTCGG - Intergenic
914351210 1:146842150-146842172 GCTGGCTCCTGCTTGAGCCTTGG - Intergenic
915052329 1:153088737-153088759 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
915464768 1:156090614-156090636 GCAGTCTGACCCCAGAGCCTGGG + Intronic
916106213 1:161434415-161434437 CCAGTCTCCTGCCTGCCCCTGGG + Intergenic
917661558 1:177181820-177181842 GCAGCCTCCTCCGGAAGCCTCGG + Intronic
918447092 1:184626878-184626900 GCATTCTCATCCCTGGGTCTAGG - Exonic
919028179 1:192203696-192203718 CCAGTTTCCTCCCTGAACTTGGG + Intergenic
919838847 1:201594778-201594800 GCAGGCTCCACCCTGAAACTGGG + Intergenic
919991103 1:202709271-202709293 GCAGTGTCCTCCCTTACCCCTGG - Intronic
920284788 1:204871587-204871609 GCTGTCTCCCTCCTGAGTCTTGG + Intronic
920313402 1:205061498-205061520 CCAGTCTCCTCCCTGACTTTTGG - Intronic
921165159 1:212501894-212501916 GCCTTCTCCTCTCTGGGCCTTGG - Intergenic
921250161 1:213290038-213290060 CCATTCTCCTGCCTCAGCCTTGG - Intergenic
921769737 1:219022141-219022163 GCAGTATTCACCGTGAGCCTTGG + Intergenic
921856856 1:219995857-219995879 GAATTCTCCAGCCTGAGCCTAGG + Intronic
922455868 1:225773040-225773062 GCAGTCTAATCCCTGAGGCTTGG - Intergenic
922705842 1:227789615-227789637 GCAGTCACAGCCCTGAGCCCCGG + Intergenic
1063040880 10:2336246-2336268 GTAATCCTCTCCCTGAGCCTGGG - Intergenic
1064431610 10:15275926-15275948 GTATTTTCCTCTCTGAGCCTTGG - Exonic
1064978937 10:21147205-21147227 ACACTCCCCTCTCTGAGCCTGGG + Intronic
1066202755 10:33158065-33158087 GCAGGCTCCTTCCTAAGCCAAGG - Intergenic
1067478945 10:46583271-46583293 GCTCTCTCCTCCCTGAGATTTGG - Intronic
1067615793 10:47758530-47758552 GCTCTCTCCTCCCTGAGATTTGG + Intergenic
1067752844 10:48983336-48983358 GCAGTCTCTTCCCAGGGCCCCGG + Intergenic
1067910818 10:50344765-50344787 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1068040226 10:51815046-51815068 GCTGGCCTCTCCCTGAGCCTGGG + Intronic
1068957841 10:62836061-62836083 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1069133318 10:64732593-64732615 GCAGTCTCCTCTTTGCCCCTGGG - Intergenic
1069442397 10:68440400-68440422 GGATTCTCCTGCCTCAGCCTTGG + Intronic
1069750915 10:70744381-70744403 GCAAGCTCCTCCCTGAGTTTGGG + Intronic
1070253926 10:74797855-74797877 GCAGGCTCAACCCTGAGCTTGGG - Intergenic
1071509493 10:86252268-86252290 GCAGTGTCTTCCTTCAGCCTCGG + Intronic
1072618247 10:97063683-97063705 GCAGCCTCCTGCCTGAGATTGGG - Intronic
1072664197 10:97381883-97381905 GCCGTCTCAGCCCTGAGCCCTGG - Intronic
1073069169 10:100782522-100782544 CCACTCTCTTCCCTCAGCCTAGG - Intronic
1074031658 10:109695140-109695162 ACAGTCTCCTGCCTCACCCTTGG + Intergenic
1075506535 10:123027819-123027841 ACAGTGTCTTCCCTGAGCTTGGG + Intronic
1075844008 10:125530313-125530335 GACGTAACCTCCCTGAGCCTTGG - Intergenic
1076740098 10:132478641-132478663 GCAGCCTCCACCCTGCCCCTGGG + Intergenic
1077101728 11:825475-825497 GCAGCCTCCTGGCTGACCCTTGG + Exonic
1077173328 11:1178021-1178043 GCAGCCTCCTCCCTGTGACTGGG + Intronic
1077296763 11:1830007-1830029 GCAGCCTCCTCCCAGAGGCTCGG + Intronic
1077523791 11:3051790-3051812 CCTGTCCCCTCCCTGAGCCTTGG + Intronic
1077887556 11:6396814-6396836 GCAGTCTGATTCCAGAGCCTGGG + Intronic
1078182771 11:9026671-9026693 TCAGCCTCCTCCCTCAGCCTGGG + Intronic
1078576899 11:12510181-12510203 ACAGTCTCCTTCCTCACCCTTGG - Intronic
1079648504 11:22896514-22896536 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
1081265501 11:41015883-41015905 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1081765226 11:45605753-45605775 GCACTCTCCTCCCTGGGCCTTGG - Intergenic
1083018196 11:59478103-59478125 GCCCTCTCCTGCCTGAGACTTGG - Exonic
1083283238 11:61640562-61640584 GCACTCACCTCTCTGGGCCTTGG + Intergenic
1083440336 11:62671971-62671993 GCCGCCTCCTCCCTGCTCCTTGG - Exonic
1083706097 11:64517423-64517445 CCAGTCTTCTCCCTGTGCATTGG + Intergenic
1083837523 11:65281323-65281345 GCAGTCAGGTCCCAGAGCCTGGG - Intronic
1084183388 11:67457617-67457639 GCCGTCTCCTCCCTCAGCTTTGG - Exonic
1084226367 11:67716978-67717000 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1084229368 11:67739827-67739849 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1084252948 11:67915894-67915916 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1084259813 11:67968738-67968760 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1084463054 11:69306933-69306955 GAAGCCACCTCCCTGGGCCTTGG + Intronic
1084536147 11:69758436-69758458 GCAGCCTCTGCCCTGAGTCTGGG + Intergenic
1084767699 11:71323378-71323400 GCATTTACCTCCCTGGGCCTGGG - Intergenic
1084819920 11:71680104-71680126 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1085305199 11:75481868-75481890 TCAGGCTCTTCCCTGAGCCTTGG + Intronic
1086080721 11:82900399-82900421 GCAGTCTCCAGCCTGAGCCATGG - Exonic
1086367938 11:86126880-86126902 GGTGTCTTCTCCCTGGGCCTTGG - Intergenic
1090381760 11:126332296-126332318 CCTGACTCCTCCCTGGGCCTAGG + Intronic
1090613128 11:128489543-128489565 TCAGTGTCCTCTCTGAGGCTTGG - Intronic
1091010359 11:131995595-131995617 CCAGTCTCCTCTCTCAGCCTTGG - Intronic
1091057269 11:132430745-132430767 GCAGTCTCCCCCCTCCGTCTTGG + Intronic
1091584688 12:1809448-1809470 ACCGCCTCCTGCCTGAGCCTCGG - Intronic
1092236698 12:6815014-6815036 GCAGTCTCCTCCCTGCCCCAGGG + Intronic
1092261059 12:6953542-6953564 CCAGTGTCACCCCTGAGCCTGGG + Intronic
1092423194 12:8350716-8350738 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1092434009 12:8431897-8431919 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1093475208 12:19547291-19547313 GCCTTCAACTCCCTGAGCCTGGG + Intronic
1095235937 12:39795806-39795828 GAAGTTTCCTCCCTCAGCCATGG - Intronic
1097998996 12:65921362-65921384 CCATTCTCCTGCCTCAGCCTGGG + Intronic
1100840617 12:98608527-98608549 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
1101601788 12:106215938-106215960 GCAGTCTTTCCACTGAGCCTGGG - Intergenic
1102166609 12:110811818-110811840 GCTGCCTCCTCCTTGACCCTTGG + Intergenic
1102237002 12:111299608-111299630 GCAGTGGCTTCCCTGAGCTTAGG + Intronic
1103357325 12:120331335-120331357 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1103398041 12:120623009-120623031 GCAGTCTCCTTGCTGCCCCTGGG + Intergenic
1104582392 12:130020609-130020631 TCGGTCTCCTGCCTCAGCCTGGG + Intergenic
1104682795 12:130762798-130762820 GCAGTCACCTCTCAGAGGCTCGG + Intergenic
1104898932 12:132177448-132177470 GCCGCCTCCTCCTAGAGCCTAGG - Intergenic
1106787733 13:33123846-33123868 GAAGCCTTCTCCCTGAGACTCGG + Intronic
1107106595 13:36649802-36649824 ACATTCTCCTGCCTCAGCCTAGG - Intergenic
1110638120 13:77790274-77790296 GCATTCTCCTCCCTGAGATCTGG - Intergenic
1111396320 13:87672705-87672727 GCAGTCTCCTCGCCCTGCCTGGG + Exonic
1111721425 13:91950304-91950326 GCATTCTCTTCCTTCAGCCTGGG + Intronic
1112653763 13:101426564-101426586 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1113151592 13:107269850-107269872 CCATTCTCCTGCCTCAGCCTTGG + Intronic
1113363294 13:109651806-109651828 CCAGACTGGTCCCTGAGCCTGGG - Intergenic
1113672497 13:112184485-112184507 GGGGTCTCCGGCCTGAGCCTGGG - Intergenic
1113979734 13:114264453-114264475 CAAGTCTCCTACCTCAGCCTGGG - Intronic
1114171343 14:20275075-20275097 TCATTCTTCTCCCTGAGCGTGGG - Intronic
1114185781 14:20401090-20401112 GAAGTCGCCTTCCTGGGCCTTGG - Exonic
1114616023 14:24068861-24068883 TCAGCCTCCTCCCTGACCCCTGG - Exonic
1116292447 14:43060707-43060729 GCATTCTCCTGCCTCAGCCTCGG - Intergenic
1116810791 14:49537996-49538018 TCAGTCTCCTCCATGATTCTAGG - Intergenic
1117164989 14:53024285-53024307 GCTGTCTGCTTCCTGAGCCTGGG - Intergenic
1118854365 14:69610088-69610110 CTTGTCCCCTCCCTGAGCCTTGG + Intergenic
1119730430 14:76947583-76947605 GCTTTCCCCTCCCTGAGCTTTGG - Intergenic
1121026928 14:90622977-90622999 TCACTCTCCTCCATGACCCTGGG + Intronic
1121234309 14:92380866-92380888 GCAGTCACCTCCCTGGTCCACGG - Intronic
1121415195 14:93774538-93774560 GGAGCCTCCTGCCTGATCCTTGG + Intronic
1121506402 14:94480918-94480940 GCAGTCATCTCCCTGATCCCTGG - Intergenic
1122066596 14:99178082-99178104 GGAGTCTCCACCCTGCCCCTCGG - Intronic
1122807981 14:104270316-104270338 GCTGTCTCGACCCTGACCCTGGG + Intergenic
1122875456 14:104662259-104662281 GCTGTCTCGACCCTGACCCTGGG - Intergenic
1122883479 14:104700340-104700362 GCACTCTCCACCCTGGCCCTCGG - Intronic
1123025348 14:105421291-105421313 CCAGGCTGCTCCCTGAGCGTGGG - Intronic
1123108739 14:105855377-105855399 GCCATCTACTCCCTGAGCCTTGG - Intergenic
1125511634 15:40295324-40295346 GCTGTCCCCTCCCTCAGTCTTGG + Intronic
1125743816 15:41985808-41985830 GCAGCCTCCCTCCTGAGCATGGG - Intronic
1125769406 15:42154840-42154862 TCGGCCTCCTCCCTGTGCCTGGG - Intronic
1129039779 15:72676047-72676069 GAAGTCTCCACCCTGAGCCCAGG - Exonic
1129738609 15:77979100-77979122 CCAGTCTCCACCCCAAGCCTGGG + Intergenic
1129844334 15:78761334-78761356 GCTGTCTGCTCCCTGCCCCTAGG - Intronic
1129953525 15:79612694-79612716 GCATTCTCCACTCTGACCCTGGG - Intergenic
1130254440 15:82319398-82319420 CCAGTCTCCACCCCAAGCCTGGG + Intergenic
1130257467 15:82332445-82332467 GCTGTCTGCCCCCTGACCCTAGG + Intergenic
1130597477 15:85257520-85257542 GCTGTCTGCCCCCTGACCCTAGG - Intergenic
1130600525 15:85270572-85270594 CCAGTCTCCACCCCAAGCCTGGG - Intergenic
1131222356 15:90595454-90595476 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1132390294 15:101433747-101433769 TCTTCCTCCTCCCTGAGCCTTGG + Intronic
1132757465 16:1493131-1493153 GCCGTCTCTTCCCTCCGCCTCGG - Intergenic
1132996625 16:2826936-2826958 GCTGTTTCCTCCCAGGGCCTTGG - Intergenic
1134006176 16:10819949-10819971 GCTGTCTCATCTCTGATCCTGGG + Intergenic
1134507058 16:14816517-14816539 GCTGTCACTTCTCTGAGCCTTGG - Intronic
1134694758 16:16215258-16215280 GCTGTCACTTCTCTGAGCCTTGG - Intronic
1136146892 16:28321271-28321293 CCAGACGCCTCCCTGAGCCCTGG + Exonic
1136351905 16:29715859-29715881 GGATTCTCCTGCCTCAGCCTGGG + Intergenic
1137015472 16:35369832-35369854 TGACTGTCCTCCCTGAGCCTTGG - Intergenic
1138546797 16:57724515-57724537 TCTGTCTTCTCCCTGGGCCTGGG + Intronic
1139366938 16:66439324-66439346 GCAGTCTCCTCTCCTGGCCTGGG - Intronic
1139982826 16:70873396-70873418 GCTGGCTCCTGCTTGAGCCTTGG + Intronic
1141422428 16:83925681-83925703 GCACTGTCCTCCCTCAGTCTGGG + Exonic
1141588386 16:85050452-85050474 CCATTCTCCTGCCTCAGCCTTGG + Intronic
1141985184 16:87575274-87575296 GGAGGCTCCTCCCTTAGGCTGGG - Intergenic
1142142237 16:88477830-88477852 GCAGCCACCTACTTGAGCCTGGG + Intronic
1142395130 16:89827968-89827990 GCAGTGGCCTCCCCGAGCCCCGG - Intronic
1142877648 17:2861742-2861764 CCATTCTCCTGCCTCAGCCTGGG + Intronic
1143509418 17:7387257-7387279 GCAGCCTCCACCCTGGGCCCTGG + Intronic
1143630796 17:8139160-8139182 TCCCTCTCCTCCCTGAGCATAGG + Intergenic
1144438182 17:15259831-15259853 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1146617286 17:34367071-34367093 GGATTCTCCTGCCTCAGCCTGGG - Intergenic
1147183564 17:38702063-38702085 GCAGCCTCTTCCCCGAGCCTGGG + Intergenic
1147627052 17:41907028-41907050 CCAGCCTCTTCCCTGGGCCTGGG + Intronic
1147764401 17:42824066-42824088 GGAGTCCCTTCCCTGACCCTGGG - Intronic
1148013447 17:44504014-44504036 GTAGGCTCCTCGCTGTGCCTCGG - Intergenic
1148061468 17:44839675-44839697 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1148233746 17:45953465-45953487 TCAGCCTCCACCCTGATCCTGGG - Intronic
1148683849 17:49489840-49489862 GCAGCCATCTCCCTGAGTCTAGG - Intergenic
1149651442 17:58278830-58278852 CCTGTCTCCTTCCTGCGCCTGGG - Intronic
1149655545 17:58308053-58308075 GCATTCCTCTCCCGGAGCCTCGG + Intronic
1150549077 17:66192224-66192246 GAAGTCTCCGCCCCCAGCCTGGG - Intergenic
1151152684 17:72101398-72101420 CCAGTCTCCTTTCTGACCCTGGG + Intergenic
1151861090 17:76762549-76762571 CCATTCTCCTGCCTCAGCCTGGG - Intronic
1152233795 17:79128082-79128104 GGAGTCTGCTCCCTGAGGGTAGG - Intronic
1152294468 17:79458700-79458722 GCAGTCTGCTTCCTGAGCGGAGG + Intronic
1152472380 17:80497175-80497197 GCCTTCACGTCCCTGAGCCTGGG + Intergenic
1152660550 17:81540034-81540056 CCAGCCTCCTCCCTCAGCCTGGG - Exonic
1152822544 17:82444712-82444734 GCTGTTTCCTGCCTGAGGCTGGG + Intronic
1153302760 18:3606197-3606219 TCTGTCTCATTCCTGAGCCTTGG + Intronic
1153886854 18:9475268-9475290 TCAGTCTCCTCAGCGAGCCTGGG + Intronic
1154043902 18:10886236-10886258 GCAGTATCCACCCTCATCCTGGG + Intronic
1154197923 18:12279680-12279702 GCTGCCTCCTCCCTGAGGCCTGG - Intergenic
1155073739 18:22337809-22337831 TCTGTTTCCTCCCTGAGGCTGGG + Intergenic
1156500175 18:37552504-37552526 GCAGGCTCCTCCTCCAGCCTTGG + Intronic
1157337665 18:46753466-46753488 CCATTCTCCTGCCTCAGCCTTGG - Intronic
1157712139 18:49857436-49857458 GCAGTCTCCTTCCTTACCCTGGG - Intronic
1158712014 18:59846003-59846025 TCATTCTCCTGCCTCAGCCTGGG - Intergenic
1159241862 18:65751502-65751524 GCAGGCTCCTCCCTCAACCTCGG + Intronic
1160148475 18:76382929-76382951 GGAATCTCCTGCCTCAGCCTCGG - Intronic
1160306868 18:77748043-77748065 GCAGTATCCTCCCTCCGCCTTGG - Intergenic
1160335476 18:78034925-78034947 ACAGTCTCCTCCCTTAGACAAGG - Intergenic
1160400271 18:78605504-78605526 GCAGTGGCGTGCCTGAGCCTGGG - Intergenic
1161284139 19:3460105-3460127 GAACTCCCCTCCCTTAGCCTCGG + Intronic
1161554781 19:4934824-4934846 GGAGCCTCCTCACTGAGTCTGGG + Intronic
1161763290 19:6190166-6190188 GTTGTCTGCTCCCTGAGCCCAGG - Intronic
1162017881 19:7855564-7855586 GCAGGCTCCTCTTTGAGTCTGGG - Intronic
1162519960 19:11173962-11173984 GGTGTCTCCTCCATCAGCCTGGG + Intronic
1162520004 19:11174129-11174151 GGTGTCTCCTCCATCAGCCTGGG + Intronic
1162930133 19:13953434-13953456 ACAGTCTCCGCCCTTAGCCTGGG + Intronic
1163012777 19:14435449-14435471 GCCTTCGCCTCTCTGAGCCTCGG + Intronic
1163533867 19:17866088-17866110 TCAGTCCCCTCCCTGTGCCTTGG + Intergenic
1163810699 19:19429654-19429676 CCTGTCTCCTCCCTCAGCCATGG - Intronic
1163865767 19:19772102-19772124 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
1164049048 19:21568435-21568457 TCTGTCTCCTCCCTGTCCCTGGG + Intergenic
1164102212 19:22066554-22066576 GCTCTCTACTCCCTGAGACTGGG - Intronic
1164474826 19:28567676-28567698 TCTGTCTCCTCCATGAGACTGGG - Intergenic
1164579010 19:29422867-29422889 GCTGTCTCCTCCTGGAGCCAGGG - Intergenic
1165371097 19:35406716-35406738 GCAACCTCTTCCCTGAGCCCAGG - Intergenic
1165955017 19:39497166-39497188 GCAGTCCCCTGCCTCAGCCTCGG + Intergenic
1166673282 19:44724200-44724222 GCCAGCTCCTTCCTGAGCCTGGG - Intergenic
1166719655 19:44989783-44989805 GCATGCTCCTCTCTGAGCCCTGG - Intronic
1167399006 19:49252504-49252526 GTACCCTCTTCCCTGAGCCTGGG - Intergenic
1168112877 19:54204266-54204288 GGATTCTCCTGCCTCAGCCTGGG - Intronic
1168131721 19:54325496-54325518 TCTGTCACCTACCTGAGCCTGGG - Intergenic
1168201886 19:54821604-54821626 GCTCTCTCCTGCCTGAACCTTGG - Exonic
1168232886 19:55044633-55044655 GCATGGTCCTCTCTGAGCCTTGG - Exonic
1168235450 19:55060189-55060211 ACTGTCTCCTGCCTGACCCTGGG + Intronic
925037637 2:703039-703061 ACTGTCTCCTGCCTGCGCCTGGG - Intergenic
925183300 2:1830761-1830783 GGAGCCTCTTCCCTGGGCCTAGG + Intronic
926277602 2:11416563-11416585 GCAGTTTCTTCCCTGTTCCTTGG - Intergenic
928100821 2:28436580-28436602 GGAGTCTCCTGTCTGAGCCAGGG + Intergenic
928939903 2:36717281-36717303 CCATTCTCCTGCCTCAGCCTGGG + Intronic
929545514 2:42853045-42853067 GCAGTCACCTTCCTAAGACTTGG - Intergenic
929814951 2:45223285-45223307 GGAATCTGTTCCCTGAGCCTTGG - Intergenic
932467642 2:71933789-71933811 GCACTGTCCTCCCTCAGCATTGG - Intergenic
932493376 2:72134951-72134973 GCAGGCTCCCATCTGAGCCTCGG + Intronic
932701033 2:73991698-73991720 GGATTCTCCTGCCTCAGCCTAGG - Intronic
932959515 2:76396640-76396662 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
935145084 2:100390208-100390230 GCATGCTCCTCCCTCAGCTTTGG + Intergenic
935553370 2:104481356-104481378 GCACACTCTTCCCTGAGCCAAGG - Intergenic
937847618 2:126598869-126598891 GCAATCCTCACCCTGAGCCTGGG - Intergenic
937861409 2:126714384-126714406 TCTGTCTCCTCCCTGTTCCTGGG - Intergenic
937984330 2:127631820-127631842 GCGGTGTCCTCTCTGAGCCTCGG - Intronic
937989179 2:127652964-127652986 CCAATCTCCTTCCTGAGCCAAGG - Intronic
938111899 2:128573493-128573515 ACAGGCTCATACCTGAGCCTAGG - Intergenic
938263053 2:129908921-129908943 GCAGCCTCCTCTCTGCTCCTCGG + Intergenic
939580261 2:143938277-143938299 GCAATCTCCACCCTGTCCCTGGG + Exonic
940141229 2:150493184-150493206 GCAGTCTCCCCTCTCATCCTGGG - Intronic
942103552 2:172610422-172610444 GGGGGCTCCTCCCTGTGCCTAGG + Intergenic
944712478 2:202347300-202347322 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
948151315 2:235747200-235747222 TGAGTCTCCTGCCTGAGCCAAGG + Intronic
948694372 2:239725795-239725817 GCAGCCTCCAGCCTGGGCCTGGG + Intergenic
948892585 2:240914679-240914701 GCAGGCTCCTCGGTCAGCCTGGG - Intergenic
1169112719 20:3044176-3044198 CGAGCCTTCTCCCTGAGCCTGGG - Intronic
1170770575 20:19328898-19328920 GCTGGCTCCTCGCAGAGCCTGGG - Intronic
1171401071 20:24873312-24873334 GCTGTCTGGTCCCTGAGTCTGGG - Intergenic
1172208698 20:33182419-33182441 GATGTCACCTCTCTGAGCCTGGG - Intergenic
1174238408 20:49113131-49113153 GCAGTCTCCTCTCAGCTCCTTGG + Intergenic
1174637440 20:52013812-52013834 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
1175971145 20:62687382-62687404 GCTGGCTCCTCCCCGGGCCTCGG - Intergenic
1176107060 20:63394429-63394451 GCAGCCTCCTCCCACAGCCCAGG - Intergenic
1176122813 20:63461747-63461769 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176122864 20:63461899-63461921 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176122874 20:63461929-63461951 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176122909 20:63462049-63462071 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176122950 20:63462170-63462192 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176122959 20:63462200-63462222 GCAGCCTCCTCCCTGCTCCCTGG - Intronic
1176148690 20:63577637-63577659 GCAGTCTCCACCCTGTGCCATGG + Intergenic
1176660763 21:9633511-9633533 GCATCCTTCTCCCTGATCCTAGG + Intergenic
1177771350 21:25519579-25519601 GCAGTACTCCCCCTGAGCCTTGG + Intergenic
1177786974 21:25681875-25681897 CCATTCTCCTGCCTCAGCCTTGG - Intronic
1178402508 21:32298893-32298915 GCAGTCTCCTCCCAGGGGCTTGG + Intronic
1179033054 21:37736693-37736715 GGGGACTCCTCCATGAGCCTGGG + Intronic
1179526020 21:41976341-41976363 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1180067227 21:45418545-45418567 GCTGCCTCCTTGCTGAGCCTCGG + Intronic
1180378620 22:12117443-12117465 GCAGTCCCCTCACTGTGGCTGGG - Intergenic
1181109281 22:20591830-20591852 CCTGTGTCCTCCCTGAGCCCAGG + Intergenic
1181123531 22:20688789-20688811 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1181189640 22:21128852-21128874 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1181209563 22:21281652-21281674 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1181487562 22:23241279-23241301 GCGGTCACCACCCTGAGCCCGGG - Intronic
1181532576 22:23525297-23525319 GAAGGGTCCTCCCCGAGCCTGGG + Intergenic
1182567331 22:31210197-31210219 ACAGTCAACTCTCTGAGCCTAGG - Intergenic
1183039009 22:35162086-35162108 GCACTGTCCTCCCTGGACCTGGG - Intergenic
1183487562 22:38097647-38097669 CCATTCCCCTTCCTGAGCCTGGG - Intronic
1183715290 22:39529728-39529750 GCGGTCTCAGCCCTGAGCATAGG - Intronic
1184841331 22:47054044-47054066 GCAGTTCCCTCCCTGAGCAATGG + Intronic
1184943344 22:47784261-47784283 GCAGTGCCCTCCTTCAGCCTTGG + Intergenic
1203217384 22_KI270731v1_random:13783-13805 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
950104196 3:10378010-10378032 GCCGTCTGCTACCAGAGCCTTGG + Intronic
950441743 3:13014643-13014665 CCAGGCTGCTCCCTGAGGCTGGG + Intronic
950565021 3:13764201-13764223 GCAGACTGCTCCCTGAGCCTCGG + Intergenic
950628825 3:14267865-14267887 GCTGTCCCCTGCCTGAGCCCTGG + Intergenic
950673189 3:14539460-14539482 CCACTGCCCTCCCTGAGCCTTGG + Intronic
950677679 3:14564442-14564464 GCCGTCCCCTCCCTGAGACATGG - Intergenic
950707164 3:14790051-14790073 GCAATCTCTTCCCTGAGCCGAGG - Intergenic
951869191 3:27341558-27341580 AAAGTATCATCCCTGAGCCTGGG - Intronic
952746577 3:36787545-36787567 GGAGGCTCCTCCCTCAGCTTGGG + Intergenic
953129540 3:40124844-40124866 GCAGTCTCCTCCATGACTTTGGG + Intronic
953464081 3:43104536-43104558 GCACGTTCCTTCCTGAGCCTTGG - Intronic
953994972 3:47512879-47512901 GCAGTCTCCTCTGAGCGCCTGGG + Intronic
954013487 3:47663919-47663941 GAAGTCTCAACCCTGAGCCCAGG + Intronic
954717598 3:52534113-52534135 GCTGTCTCCTCTCGGCGCCTCGG - Intronic
955356511 3:58237129-58237151 CCCCTCACCTCCCTGAGCCTCGG + Intergenic
955924645 3:63993343-63993365 CCATTCTCCTGCCTCAGCCTTGG - Intronic
956037867 3:65115043-65115065 GTGGTCTCCTCCCTGGGCTTTGG + Intergenic
956307560 3:67842715-67842737 GCAGTCACCTTTCTGGGCCTCGG - Intergenic
956588534 3:70889011-70889033 ACAGTCACCTCAATGAGCCTGGG + Intergenic
956883506 3:73535134-73535156 GCAGGCTGCTCCTTTAGCCTGGG + Intronic
958829320 3:99068266-99068288 GCTGTCTGCTACCTGACCCTTGG - Intergenic
961658447 3:128455969-128455991 CCAGCCTCCTCCCTGGGCCCTGG - Intergenic
961900618 3:130207251-130207273 CCATTCTCCTGCCTCAGCCTTGG - Intergenic
962900314 3:139756020-139756042 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
963463500 3:145647611-145647633 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
965245081 3:166257864-166257886 GCAGTTTCATTCCTGAGCCGGGG - Intergenic
967037219 3:185656973-185656995 GCAGTCCCTTCCCTTAGCTTGGG + Intronic
968600851 4:1508627-1508649 GGAGGCTCCCCCATGAGCCTGGG - Intergenic
968827131 4:2907301-2907323 GCAGGCTCCTCCCTAACCCTGGG + Intronic
968966201 4:3770164-3770186 GCAATCTATCCCCTGAGCCTGGG + Intergenic
968990212 4:3905811-3905833 ACTGTCTCCTGCCTGACCCTGGG - Intergenic
969012142 4:4074807-4074829 GCTGTCTCCTGCCTGCCCCTGGG + Intergenic
969018367 4:4120799-4120821 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
969307957 4:6336440-6336462 GCCTTCACCTCCCTGAGCCCTGG + Intronic
969459072 4:7318211-7318233 GGACTTACCTCCCTGAGCCTTGG - Intronic
971833751 4:31734163-31734185 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
971887893 4:32476262-32476284 CCATTCTCCTGCCTCAGCCTTGG - Intergenic
974583126 4:63832994-63833016 TCAGTCTCTTGCCTGAGGCTTGG - Intergenic
974912639 4:68141766-68141788 TCATACTCGTCCCTGAGCCTGGG - Intergenic
976016294 4:80559606-80559628 CCAGTCTCCTCCCTCACCCCTGG + Intronic
979763414 4:124435817-124435839 GCCATATCCTCCCTGAGCCTTGG + Intergenic
983661713 4:170135764-170135786 CCAGTCTCCAGCATGAGCCTAGG - Intergenic
984909358 4:184657886-184657908 CCATTCTCCTGCCTCAGCCTTGG - Intronic
985091172 4:186363930-186363952 GCAGTCTCAGCCCTTAGCCGAGG - Intergenic
985414600 4:189722905-189722927 GCATCCTTCTCCCTGATCCTAGG - Intergenic
985485693 5:146926-146948 TCAGTGTCCTACCTGAGACTTGG + Intronic
985656629 5:1135136-1135158 ACATTCACCTTCCTGAGCCTCGG + Intergenic
986501125 5:8401008-8401030 TCATACTCCTCCCTGGGCCTTGG - Intergenic
988555304 5:32231272-32231294 CAATTCTCCTCCCTCAGCCTCGG - Intronic
988889375 5:35598554-35598576 CCAGTCTCCAGCCTGAGCCCAGG + Intergenic
990257691 5:53987996-53988018 CCATTCTCCTGCCTCAGCCTCGG - Intronic
990339132 5:54805079-54805101 GTAGACTCCTCCCTCAGCCCTGG + Intergenic
993213366 5:84984709-84984731 CCAGTCTCATCCCTAAGCTTAGG - Intergenic
995072366 5:107939458-107939480 GCATACTCCTCCCTGACCCGTGG - Intronic
995672846 5:114626169-114626191 GCAGTCTGCTCTCTGTTCCTTGG - Intergenic
997670743 5:135669815-135669837 GCCATCTCATCCCTCAGCCTCGG - Intergenic
998172371 5:139880257-139880279 GCAGCCTCTACCCTGAGGCTGGG + Intronic
998225277 5:140322078-140322100 GAAGTGACCTCCCTGACCCTTGG + Intergenic
999308337 5:150535222-150535244 GGTGTGACCTCCCTGAGCCTTGG - Intronic
1000312562 5:160059343-160059365 GCAGTTTCCTCACTCAACCTTGG + Intronic
1001191650 5:169637525-169637547 GCCGTCCTCTCCCCGAGCCTCGG - Intronic
1001225232 5:169939006-169939028 CCATTCTCCTACCTTAGCCTCGG + Intronic
1001720177 5:173850736-173850758 GCAGTTTCCTCTCGGATCCTTGG + Intergenic
1002318421 5:178360592-178360614 GCAAACACCTCTCTGAGCCTCGG + Intronic
1002405680 5:179028174-179028196 GCAGCCTCCTCGCTGTGCCCTGG - Intronic
1002534283 5:179867662-179867684 GCGGCCTGCTCCCTGAGCCCAGG + Intronic
1002915778 6:1526570-1526592 GCAAGCCCCTCCCTGAGCCTTGG + Intergenic
1005494296 6:26375315-26375337 GCTGTCTCCACCCCTAGCCTGGG + Intronic
1006117765 6:31784382-31784404 CCTGGCTCCTACCTGAGCCTTGG + Exonic
1006237004 6:32642486-32642508 TCACTCTTCTCCCTAAGCCTGGG + Intronic
1006246988 6:32746117-32746139 TCACTCTTCTCCCTAAGCCTGGG + Intronic
1006985805 6:38174912-38174934 ACGGTCTCCTCCCTGAGCAGGGG - Exonic
1007286558 6:40752010-40752032 GCTGTGTCTTCCCTCAGCCTGGG + Intergenic
1007476449 6:42122814-42122836 GAGGCCTCCTGCCTGAGCCTAGG + Intronic
1007750139 6:44066468-44066490 GCTGTCTCCCCCCTCAGACTGGG + Intergenic
1007750181 6:44066621-44066643 GCTGTCTCCCCCCTCAGACTGGG + Intergenic
1007750193 6:44066659-44066681 GCTGTCTCCCCCCTCAGACTGGG + Intergenic
1009610428 6:65933669-65933691 GCAGTCTCTTCCCCGAGGGTGGG + Intergenic
1010524254 6:76880957-76880979 GTAGTCTCCTCCCTGAGGCTGGG - Intergenic
1012848424 6:104418743-104418765 TCAGCCTCCTGCCTAAGCCTTGG + Intergenic
1013152594 6:107460150-107460172 CCGGCCTCCTCGCTGAGCCTTGG + Intergenic
1013317396 6:108955865-108955887 GCAGTCCCATCCCTGGTCCTGGG - Intronic
1015883522 6:137892983-137893005 GCCCTTTCCTCCCTGAGCATGGG - Intergenic
1015962079 6:138660534-138660556 CCATTCTCCTGCCTCAGCCTTGG - Intronic
1016406468 6:143736677-143736699 CCATTCTCCTGCCTGAGCCTCGG + Intronic
1017106871 6:150896321-150896343 GCTGTCCCCTCCCTGAGGCCTGG + Intronic
1017208700 6:151831589-151831611 GCAGTCTGACCCCAGAGCCTGGG - Intronic
1017491931 6:154952603-154952625 GGATTCTCCTGCCTCAGCCTGGG + Intronic
1017878659 6:158544591-158544613 GCATTCCCTTCCATGAGCCTCGG + Intronic
1017915822 6:158831011-158831033 GGACTGTCCTCCCTGAGTCTAGG + Intergenic
1017997105 6:159541622-159541644 GCAGACTACTCTCTGAGACTTGG - Intergenic
1018679149 6:166249409-166249431 CCATTCTCCTGCCTCAGCCTCGG + Intergenic
1018751540 6:166810802-166810824 GCAGCTTATTCCCTGAGCCTGGG - Intronic
1018861431 6:167713127-167713149 CCAGCCACTTCCCTGAGCCTGGG - Intergenic
1018866186 6:167748511-167748533 GAAGTCCCCAGCCTGAGCCTGGG + Intergenic
1019273573 7:164233-164255 GCATTCTCTGCCCTGAGCCACGG - Intergenic
1019286621 7:226468-226490 ACTCCCTCCTCCCTGAGCCTTGG - Intronic
1020310101 7:6860724-6860746 GCTGTCTCCTGCCTGACCCTGGG - Intergenic
1020313043 7:6883864-6883886 GCTGTCTCCTGCCTGACCCTGGG - Intergenic
1022398096 7:30008858-30008880 CCATTCTCCTGCCTCAGCCTGGG - Intergenic
1023294816 7:38703479-38703501 ATAGGCGCCTCCCTGAGCCTGGG + Intergenic
1023341773 7:39228857-39228879 GCAAACTCATCCATGAGCCTGGG - Intronic
1023515064 7:40993574-40993596 GCAGTTTCCTTCATGAGTCTAGG + Intergenic
1023865136 7:44234871-44234893 CCAGCCTCCTCCATGACCCTGGG + Intronic
1024208388 7:47183045-47183067 GCATTCCCCTCTCTGTGCCTTGG + Intergenic
1025779821 7:64591302-64591324 GCTGTCTACTCCCTGAGCACTGG - Intergenic
1027057008 7:75056641-75056663 TCATTCCCCTCCCTTAGCCTGGG - Intronic
1028679134 7:93505464-93505486 TCTTTCTCCTCCCTGAGTCTTGG - Intronic
1029076854 7:97941507-97941529 GCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1029436960 7:100568908-100568930 GGCCTCTCCTCCCTGACCCTCGG + Intergenic
1029728714 7:102425551-102425573 GCCATCTCCTCACTGAGCCTGGG - Exonic
1030105183 7:105981360-105981382 TCAGTTTCCTCCCTGGGACTGGG - Intronic
1031452379 7:121937631-121937653 TCAGTCTCCACCCTGACTCTGGG - Intronic
1031825176 7:126556282-126556304 GTAGTGTCATCCCTGAGCCTTGG - Intronic
1032534997 7:132655690-132655712 GCAGTTTGCAGCCTGAGCCTCGG - Intronic
1032704003 7:134406421-134406443 GCAATGGCCTCCCTGAGGCTGGG - Intergenic
1033339517 7:140480650-140480672 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1033425858 7:141243596-141243618 TCACTCTCCTCGCTGGGCCTCGG + Intronic
1034720691 7:153289941-153289963 CCAGTCTCTTCCCTGATGCTGGG + Intergenic
1034950125 7:155291292-155291314 GCAGTCCCCACGATGAGCCTGGG - Intergenic
1036240924 8:7080444-7080466 GCTGTCTCCTGCCTGCCCCTGGG + Intergenic
1038436194 8:27538410-27538432 GCAGTCTCAGCCCAGAGCTTTGG + Intronic
1038743716 8:30237683-30237705 GCTGTCTCCTCCTTGGACCTTGG - Intergenic
1039640848 8:39219203-39219225 GCACTCTGCTGCCTGAGGCTGGG + Intronic
1040340924 8:46440408-46440430 CCAGTCTCCTGCCTGCCCCTGGG - Intergenic
1041848949 8:62364731-62364753 CCATTCTCCTGCCTCAGCCTAGG - Intronic
1043463586 8:80485386-80485408 GCAGACTCCTCCCCGCTCCTGGG + Intergenic
1044677107 8:94740557-94740579 CCATTCTCCTGCCTCAGCCTCGG + Intronic
1046084976 8:109421677-109421699 CCATTCTCCTGCCTCAGCCTCGG - Intronic
1047763451 8:127971221-127971243 GCAAGCTCCTCCCTGGCCCTCGG - Intergenic
1047828288 8:128603053-128603075 CCAGTCCCTTCACTGAGCCTTGG + Intergenic
1048294670 8:133205621-133205643 GCAGGCTCCTGCCTGTGGCTGGG + Intronic
1049365056 8:142233051-142233073 GCTGTCCCCTCCCTCAGCTTGGG - Intronic
1049434720 8:142581205-142581227 GCCCTCTCCTCTCTCAGCCTGGG + Intergenic
1049465542 8:142749746-142749768 GCAGCCTCCGCCATCAGCCTTGG + Intergenic
1049754538 8:144303979-144304001 GTAGTCTCCTCTCTGAGGCTTGG + Intronic
1049761893 8:144335526-144335548 GCAGTCTCTTCCCTGAAGCCTGG - Intronic
1049825259 8:144663582-144663604 GCAGCCTCCTTCCTGCTCCTAGG + Intergenic
1050364382 9:4860679-4860701 GGACTCACCTCCTTGAGCCTTGG + Exonic
1052865371 9:33461831-33461853 GCATTCTCCTCCTTGGGCCCTGG + Exonic
1053444631 9:38142499-38142521 CCAGTCTCCTCCCTGAACTCTGG - Intergenic
1056937524 9:90927701-90927723 GCAGCCTCACCCCTGAGGCTGGG + Intergenic
1057610950 9:96543228-96543250 CCATTCTCCTGCCTCAGCCTCGG - Intronic
1057809815 9:98249167-98249189 GCACTCTCCTCCCAGACCCAGGG - Intronic
1057938269 9:99258532-99258554 CCTGTCCCTTCCCTGAGCCTTGG + Intergenic
1058005308 9:99907250-99907272 AAAGTCTCCTCTCTGAACCTCGG - Intronic
1059277800 9:113110180-113110202 GCAGTCACCTACCTGAGGCCGGG + Intergenic
1059278451 9:113114371-113114393 GCAGTCACCTACCTGAGGCCGGG - Intergenic
1059353081 9:113679387-113679409 GGCTTCACCTCCCTGAGCCTCGG - Intergenic
1060206500 9:121685521-121685543 CCTCTCTCCTCCCTAAGCCTGGG - Intronic
1060609951 9:124954767-124954789 CCAGTCCCCTCCCTCAGCCCTGG + Intronic
1061309259 9:129751761-129751783 GATGTCTCCTCTCTGAGCCCAGG + Intronic
1061408315 9:130404818-130404840 TCAGCCGCCTCCCTGAGCCCCGG + Intronic
1061857902 9:133452989-133453011 CCAGTGCCCTCCCTGAGCGTCGG + Intronic
1062187639 9:135227181-135227203 GCCTCCTCCTCCCTGGGCCTGGG + Intergenic
1062559056 9:137131132-137131154 TCAGTCTCCTCCCAAAGCATTGG - Intergenic
1062587242 9:137254929-137254951 GCAGACTCCCTCCTGAGCGTGGG - Intergenic
1203638331 Un_KI270750v1:135355-135377 GCATCCTTCTCCCTGATCCTAGG + Intergenic
1185550673 X:980830-980852 ACACTCTCCTCCCTGAGGCTGGG + Intergenic
1186120995 X:6360762-6360784 CCATTCTCCTGCCTCAGCCTGGG + Intergenic
1186660707 X:11665279-11665301 GCAGCCTTCTCCCTGGCCCTCGG - Exonic
1189292721 X:39897288-39897310 GCGTTCTCCTCCGTGGGCCTGGG - Intergenic
1189724688 X:43956201-43956223 ACACTCCCTTCCCTGAGCCTGGG + Intronic
1192363379 X:70452801-70452823 GGAGTCTCGCCCCTGAGACTGGG + Intronic
1193117160 X:77786212-77786234 CAATTCTCCTGCCTGAGCCTCGG - Exonic
1193896999 X:87127017-87127039 GCAGTACCCACCTTGAGCCTTGG + Intergenic
1194219233 X:91170783-91170805 ACTGTCTCCTGCCTGACCCTGGG + Intergenic
1200145087 X:153922206-153922228 GCTGCCACCTCCCGGAGCCTGGG - Intronic
1200145570 X:153924688-153924710 GCAGTATACTCCCAGGGCCTGGG + Intronic
1200683719 Y:6243004-6243026 GCAGTTTCCTGCATGATCCTTGG + Intergenic
1200685494 Y:6254870-6254892 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1200686320 Y:6263296-6263318 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1200687885 Y:6273479-6273501 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1200831789 Y:7692797-7692819 GCAGTCTCCTCCATGATCTTTGG - Intergenic
1200887345 Y:8282314-8282336 GCAGTCACCTCCTTGAGGCTTGG - Intergenic
1200988642 Y:9328020-9328042 GCAGTCACCTCCCTGAGGCTTGG - Intergenic
1200989203 Y:9334213-9334235 GCAGTCTCCTCCAGGATCCTTGG + Intergenic
1200991024 Y:9346111-9346133 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1200991861 Y:9354543-9354565 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1200993682 Y:9366404-9366426 GCAGTCTCCTCCCTGAGCCTTGG + Intronic
1200994515 Y:9374823-9374845 GCAGTCTCCTCCCGGATCCTTGG + Intronic
1200996345 Y:9386722-9386744 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1200997178 Y:9395169-9395191 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1200998860 Y:9455277-9455299 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1200999694 Y:9463707-9463729 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1201001514 Y:9475586-9475608 GCAGTCTCCTCCCTGAGCCTTGG + Intronic
1201002352 Y:9484015-9484037 GCAGTCTCCTCCCGGATCCTTGG + Intronic
1201004180 Y:9495888-9495910 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1201005011 Y:9504302-9504324 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1201006835 Y:9516200-9516222 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1201007669 Y:9524629-9524651 GCAGTCTCCTCCCGGATCCTTGG + Intergenic
1201009487 Y:9536506-9536528 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1201010295 Y:9544819-9544841 GCAGTCTCCTCCAGGATCCTTGG + Intergenic
1201012079 Y:9557208-9557230 GCAGTCTCCTCCTTGAGCCTTGG + Intergenic
1201047384 Y:9901223-9901245 GCAGTCTCCTCCCTGAGCCTTGG - Intergenic
1201048916 Y:9911382-9911404 GCAGTTTCCTGCATGATCCTTGG - Intergenic
1201060324 Y:10038479-10038501 GCAGTCACCTCCATGATCCTTGG - Intergenic
1201062449 Y:10059347-10059369 GCAGTCTCCTCCCTGAGCCTTGG - Intergenic
1201585975 Y:15561609-15561631 CAGATCTCCTCCCTGAGCCTGGG + Intergenic
1201767789 Y:17588884-17588906 GAAGTCTCCTCTGTGAGGCTGGG + Intergenic
1201833764 Y:18317101-18317123 GAAGTCTCCTCTGTGAGGCTGGG - Intergenic
1202110194 Y:21409518-21409540 GCAGTCACCTCCCTGAGGCTTGG - Intergenic
1202111626 Y:21427353-21427375 GCAGTCTCCTCCCTGAGCCTTGG - Intergenic
1202115119 Y:21464902-21464924 GCAGTCTCCTCCATGATCCTTGG + Intergenic
1202116818 Y:21476784-21476806 GCAGTCTCCTCCCTGAGCCTTGG + Intergenic
1202119347 Y:21508172-21508194 GCAGTCACCTCCCTGAGGCTTGG + Intergenic
1202121799 Y:21531712-21531734 GCAGTCACCTCCCTGAGGCTTGG + Intronic
1202132001 Y:21621129-21621151 TCAGTCTCCTCCTTGAGCCTTGG - Intergenic
1202157207 Y:21897670-21897692 GCAGTCACCTCCCTGAGGCTTGG - Intronic
1202159653 Y:21921211-21921233 GCAGTCACCTCCCTGAGGCTTGG - Intergenic
1202161771 Y:21941615-21941637 GCAGTCTCTTCCCTGAAGCTTGG - Intergenic
1202186098 Y:22186126-22186148 GCAGTCACCTCCCTGAGGCTTGG - Intergenic
1202190417 Y:22237277-22237299 CCATTCTCCTGCCTCAGCCTCGG - Intergenic
1202196711 Y:22305569-22305591 GCAGTCACCTCCCTGAGGCTTGG + Intergenic
1202205261 Y:22400270-22400292 GCAGTCACCTCCCTGAGGCTTGG + Intronic
1202229585 Y:22644758-22644780 GCAGTCTCTTCCCTGAAGCTTGG + Intergenic
1202313571 Y:23551407-23551429 GCAGTCTCTTCCCTGAAGCTTGG - Intergenic
1202366859 Y:24171611-24171633 GCCCTCTCCTCCCTGTGCTTTGG + Intergenic
1202503923 Y:25498512-25498534 GCCCTCTCCTCCCTGTGCTTTGG - Intergenic
1202557232 Y:26119188-26119210 GCAGTCTCTTCCCTGAAGCTTGG + Intergenic