ID: 1202116823

View in Genome Browser
Species Human (GRCh38)
Location Y:21476809-21476831
Sequence TCACTATGTGTCCTAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202116820_1202116823 -8 Left 1202116820 Y:21476794-21476816 CCCTGAGCCTTGGCTTCACTATG No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data
1202116816_1202116823 28 Left 1202116816 Y:21476758-21476780 CCATGCATGGTCTGAGTATGCTT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data
1202116817_1202116823 4 Left 1202116817 Y:21476782-21476804 CCGCAGTCTCCTCCCTGAGCCTT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data
1202116819_1202116823 -5 Left 1202116819 Y:21476791-21476813 CCTCCCTGAGCCTTGGCTTCACT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data
1202116815_1202116823 29 Left 1202116815 Y:21476757-21476779 CCCATGCATGGTCTGAGTATGCT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data
1202116821_1202116823 -9 Left 1202116821 Y:21476795-21476817 CCTGAGCCTTGGCTTCACTATGT No data
Right 1202116823 Y:21476809-21476831 TCACTATGTGTCCTAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202116823 Original CRISPR TCACTATGTGTCCTAGCTCC AGG Intergenic
No off target data available for this crispr