ID: 1202128061

View in Genome Browser
Species Human (GRCh38)
Location Y:21586012-21586034
Sequence CCTGCTGGGCAGTGTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202128052_1202128061 3 Left 1202128052 Y:21585986-21586008 CCTTTGTCTTCGCTGGACTCGGG No data
Right 1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202128061 Original CRISPR CCTGCTGGGCAGTGTGGGGC TGG Intergenic
No off target data available for this crispr