ID: 1202129671

View in Genome Browser
Species Human (GRCh38)
Location Y:21598274-21598296
Sequence CAGTCTGAGGTGTGAGAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202129671_1202129677 17 Left 1202129671 Y:21598274-21598296 CCGTATTCTCACACCTCAGACTG No data
Right 1202129677 Y:21598314-21598336 ATGAGGTTGAGAGAGTATCTTGG No data
1202129671_1202129676 0 Left 1202129671 Y:21598274-21598296 CCGTATTCTCACACCTCAGACTG No data
Right 1202129676 Y:21598297-21598319 GCTTCTTGCGGGTGCAGATGAGG No data
1202129671_1202129678 29 Left 1202129671 Y:21598274-21598296 CCGTATTCTCACACCTCAGACTG No data
Right 1202129678 Y:21598326-21598348 GAGTATCTTGGAGACGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202129671 Original CRISPR CAGTCTGAGGTGTGAGAATA CGG (reversed) Intergenic
No off target data available for this crispr