ID: 1202133526

View in Genome Browser
Species Human (GRCh38)
Location Y:21636103-21636125
Sequence CTCTGGGGCTCTCCAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202133518_1202133526 30 Left 1202133518 Y:21636050-21636072 CCCTTTGAGAAGCCTAGACCTAA No data
Right 1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG No data
1202133521_1202133526 12 Left 1202133521 Y:21636068-21636090 CCTAAACATGTTCAAAGACAGAA No data
Right 1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG No data
1202133519_1202133526 29 Left 1202133519 Y:21636051-21636073 CCTTTGAGAAGCCTAGACCTAAA No data
Right 1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG No data
1202133520_1202133526 18 Left 1202133520 Y:21636062-21636084 CCTAGACCTAAACATGTTCAAAG No data
Right 1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202133526 Original CRISPR CTCTGGGGCTCTCCAGTTTC TGG Intergenic
No off target data available for this crispr