ID: 1202133986

View in Genome Browser
Species Human (GRCh38)
Location Y:21641152-21641174
Sequence TCTTCTTGATGGTGTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202133982_1202133986 26 Left 1202133982 Y:21641103-21641125 CCCTGTTTCTTGGTCTCTTCTCT No data
Right 1202133986 Y:21641152-21641174 TCTTCTTGATGGTGTCCTACTGG No data
1202133983_1202133986 25 Left 1202133983 Y:21641104-21641126 CCTGTTTCTTGGTCTCTTCTCTT No data
Right 1202133986 Y:21641152-21641174 TCTTCTTGATGGTGTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202133986 Original CRISPR TCTTCTTGATGGTGTCCTAC TGG Intergenic
No off target data available for this crispr