ID: 1202134541

View in Genome Browser
Species Human (GRCh38)
Location Y:21648071-21648093
Sequence GAGAGATCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202134541_1202134544 9 Left 1202134541 Y:21648071-21648093 CCAGTAACAGGCCAAGATCTCTC No data
Right 1202134544 Y:21648103-21648125 GTAGTTATTTGCAGAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202134541 Original CRISPR GAGAGATCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr