ID: 1202134544

View in Genome Browser
Species Human (GRCh38)
Location Y:21648103-21648125
Sequence GTAGTTATTTGCAGAACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202134543_1202134544 -2 Left 1202134543 Y:21648082-21648104 CCAAGATCTCTCAAAAGGAGAGT No data
Right 1202134544 Y:21648103-21648125 GTAGTTATTTGCAGAACATGTGG No data
1202134540_1202134544 19 Left 1202134540 Y:21648061-21648083 CCAACAAAGTCCAGTAACAGGCC No data
Right 1202134544 Y:21648103-21648125 GTAGTTATTTGCAGAACATGTGG No data
1202134541_1202134544 9 Left 1202134541 Y:21648071-21648093 CCAGTAACAGGCCAAGATCTCTC No data
Right 1202134544 Y:21648103-21648125 GTAGTTATTTGCAGAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202134544 Original CRISPR GTAGTTATTTGCAGAACATG TGG Intergenic
No off target data available for this crispr