ID: 1202137951

View in Genome Browser
Species Human (GRCh38)
Location Y:21686771-21686793
Sequence ATTTGTCTACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202137951_1202137954 4 Left 1202137951 Y:21686771-21686793 CCTGCCATCTTCTGTAGACAAAT No data
Right 1202137954 Y:21686798-21686820 TGCTTTGGAGAGACAGCTCTTGG No data
1202137951_1202137957 22 Left 1202137951 Y:21686771-21686793 CCTGCCATCTTCTGTAGACAAAT No data
Right 1202137957 Y:21686816-21686838 CTTGGCCCATTACTGGGCTTTGG 0: 5
1: 29
2: 195
3: 165
4: 244
1202137951_1202137956 16 Left 1202137951 Y:21686771-21686793 CCTGCCATCTTCTGTAGACAAAT No data
Right 1202137956 Y:21686810-21686832 ACAGCTCTTGGCCCATTACTGGG 0: 5
1: 27
2: 194
3: 220
4: 255
1202137951_1202137955 15 Left 1202137951 Y:21686771-21686793 CCTGCCATCTTCTGTAGACAAAT No data
Right 1202137955 Y:21686809-21686831 GACAGCTCTTGGCCCATTACTGG 0: 6
1: 25
2: 183
3: 198
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202137951 Original CRISPR ATTTGTCTACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr